Skip Navigation
Skip to contents

Journal of Microbiology : Journal of Microbiology

OPEN ACCESS
SEARCH
Search

Previous issues

Page Path
HOME > Browse Articles > Previous issues
13 Previous issues
Filter
Filter
Keywords
Volume 39(1); March 2001
Prev issue Next issue
Spindle Checkpoint Control in Budding Yeast
Akio Toh-e , Kazuhide Asakawa , Satoshi Yoshida
J. Microbiol. 2001;39(1):1-10.
  • 339 View
  • 0 Download
AbstractAbstract PDF
review
Isolation of Dextran-producing Leuconostoc lactis from Kimchi
Bong-Joon Kim , Bong-Hee Min , Jeongho Kim , Hong-Ui Han
J. Microbiol. 2001;39(1):11-16.
  • 371 View
  • 1 Download
AbstractAbstract PDF
Tentative identification of Leuconostoc lactis IH23 isolated from kimchi (a fermented vegetable product) has been described previously with 16S rDNA sequencing (Choi, I., M. Sc. Thesis Inha Univ. 1999). This strain produced the slime identified as dextran based on IR, 13C- and 1H-NMR spectroscopic results. Further study proved that the isolate IH23 belongs to a homogeneous genetic group with L. lactis DSM 20202T and L. argentinum DSM 8581T. The results showed DNA-DNA homology of 99-100%, 16S rDNA gene sequence similarity (99.7%), and a phylogenetic relationship although L. argentinum DSM 8581T had lower homology (80-91%). These data indicate that L. argentinum DSM 8581T and the isolate IH23 belong to an identical species with L. lactis DSM 20202T at the genetic level, although in carbohydrate fermentation, the isolate IH23 was most closely related to L. argentinum DSM 8581T and quite different from L. lactis DSM 20202T. Here we first report the isolation of consistent phenotypic variation in Leuconostoc lactis. We also emphasize that the nomenclature of subspecies needs to be differentiated into the three strains mentioned above in Leuconostoc lactis.
An Improved Selective Isolation of Rare Actinomycetes from Forest Soil
Chi Nam Seong , Ji Heok Choi , Keun-Shik Baik
J. Microbiol. 2001;39(1):17-23.
  • 366 View
  • 2 Download
AbstractAbstract PDF
Various pretreatment procedures and selective media were applied to assess the optimal conditions for the isolation of rare actinomycetes from soil. Pretreatment of wet-heating for 15 min at 70oC and phenol treatment of soil suspension were the most effective methods for the isolation of those microorganisms. Hair hydrolysate vitamin agar (HHVA) was the most suitable medium for the recovery of rare actinomycetes. Thirty-five rare actinomycete strains were chosen using selective isolation approaches, then morphological and chemical properties of the isolates were determined. The isolates belonged to one of the following genus, Micromonospora, Microbispora, Actinoplanes and Streptosporangium.
Regulation of Glycogen Concentration by the Histidine-Containing Phosphocarrier Protein HPr in Escherichia coli
Byoung-Mo Koo , Yeong-Jae Seok
J. Microbiol. 2001;39(1):24-30.
  • 367 View
  • 0 Download
AbstractAbstract PDF
In addition to effecting the catalysis of sugar uptake, the bacterial phosphoenolpyruvate:sugar phosphotransferase system regulates a variety of physiological processes. In a previous paper [Seok et al., (1997) J. Biol. Chem. 272, 26511-26521], we reported the interaction with and allosteric regulation of Escherichia coli glycogen phosphorylase activity by the histidine-containing phosphocarrier protein HPr in vitro. Here, we show that the specific interaction between HPr and glycogen phosphorylase occurs in vivo. To address the physiological role of the HPr-glycogen phosphorylase complex, intracellular glycogen levels were measured in E. coli strains transformed with various plasmids. While glycogen accumulated during the transition between exponential and stationary growth phases in wildtype cells, it did not accumulate in cells overproducing HPr or its inactive mutant regardless of the growth stage. From these results, we conclude that HPr mediates crosstalk between sugar uptake through the phosphoenolpyruvate:sugar phosphotransferase system and glycogen breakdown. The evolutionary significance of the HPr-glycogen phosphorylase complex is suggested.
Cloning and Regulation of Schizosaccharomyces pombe Gene Encoding Ribosomal Protein S20
Yoon-Jong Lee , Kyunghoon Kim , Eun-Hee Park , Ki-Sup Ahn , Daemyung Kim , Chang-Jin Lim
J. Microbiol. 2001;39(1):31-36.
  • 361 View
  • 0 Download
AbstractAbstract PDF
A cDNA clone encoding the ribosomal protein S20 has been isolated from the Schizosaccharomyces pombe cDNA library by colony hybridization. The insert contained in the original plasmid pYJ10 was transferred into shuttle vector pRS316 to generate plasmid pYJ11. The cDNA insert of plasmid pYJ11 contains 484 nucleotides and encodes a protein of 118 amino acids with a calculated mass of 13,544 daltons. The deduced amino acid sequence of S. pombe ribosomal protein S20 is very homologous with fruit fly, rat, and budding yeast counterparts. It is also homologous with Xenopus S22 ribosomal protein. S. pombe ribosomal protein S20 appears to be relatively hydrophobic except the C-terminal region. The 728 bp upstream region of the S20 gene was amplified from chromosomal DNA and transferred into the BamHI/EcoRI site of the promoterless b-galactosidase gene of the vector YEp357R, which resulted in fusion plasmid pYS20. The synthesis of b-galactosidase from the fusion plasmid appeared to be the highest in the mid-exponential phase. The S. pombe cells with the fusion plasmid grown at 35oC gave lower b-galactosidase activity than the cells grown at 30oC. Computer analysis showed the consensus sequence CAGTCACA in the upstream regions of various ribosomal protein genes in S. pombe, which would be involved in the coordinated expression of small ibosomal proteins.
Isolation and Characterization of the sod2+ Gene Encoding a Putative Mitochondrial Manganese Superoxide Dismutase in Schizosaccharomyces pombe
Jae-Hoon Jeong , Eun-Soo Kwon , Jung-Hye Roe
J. Microbiol. 2001;39(1):37-41.
  • 319 View
  • 0 Download
AbstractAbstract PDF
The fission yeast Schizosaccharomyces pombe contains two distinct superoxide dismutase (SOD) activities, one in the cytosol encoded by the sod1+ gene and the other in mitochondria. The sod2+ gene encoding putative mitochondrial manganese superoxide dismutase (MnSOD) was isolated from the S. pombe genomic library using a PCR fragment as the probe. The nucleotide sequence of the sod2+ gene and its flanking region (4051 bp HindIII fragment) was determined. An intron of 123 nt in size was predicted and confirmed by sequencing the cDNA following reverse transcription PCR. The predicted Sod2p consists of 218 amino acid residues with a molecular mass of 24,346 Da. The deduced amino acid sequence showed a high degree of homology with other MnSODs, especially in the metal binding residues at the active site and their relative positions. The transcriptional start site was mapped by primer extension at 231 nt upstream from the ATG codon. A putative TATA box (TATAAAA) was located 58 nt upstream from the transcriptional start site and putative polyadenylation sites were located at 1000, 1062, and 1074 nt downstream from the ATG start codon.
Regulation of Actin Gene Expression During the Differentiation of Naegleria gruberi
Misook Kim , JooHun Lee
J. Microbiol. 2001;39(1):42-48.
  • 358 View
  • 0 Download
AbstractAbstract PDF
The regulation of actin gene expression during the differentiation of Naegleria gruberi was examined. Actin mRNA concentration was maximal in amoebae and decreased rapidly after the initiation of differentiation. At 20 min after initiation, the concentration of actin mRNA decreased to 55% of the maximal value. The actin mRNA concentration decreased to the minimum at 80 min (15% of the maximum), and then began to increase slightly at the end of differentiation. This decrease of actin mRNA concentration was regulated by the repression of actin gene transcription based on nuclear runon transcription experiments. The rates of transcription of actin gene in nuclei prepared at 40 and 80 min after the initiation of differentiation were 50 and 28% of that of nuclei prepared at the beginning of differentiation, respectively. The addition of cycloheximide at the initiation of differentiation inhibited both the rapid decrease in the concentration of actin mRNA and the repression of actin gene transcription. These results suggest that the rapid decrease in the concentration of actin mRNA during the differentiation of N. gruberi is accomplished by the repression of actin gene transcription and this transcriptional regulation requires continuous protein synthesis during the differentiation.
Molecular Cloning and Characterization of cDNA Encoding Immunoglobulin Heavy and Light chain Variable Regions from Four Chicken Monoclonal Antibodies Specific to Surface Antigens of Intestinal Parasite, Eimeria acervulina
Ki Duk Song , Jae Yong Han , Wongi Min , Hyun S. Lillehoj , Sung Won Kim , Jin-Kyoo Kim
J. Microbiol. 2001;39(1):49-55.
  • 302 View
  • 0 Download
AbstractAbstract PDF
We have developed four chicken hybridomas secreting monoclonal antibodies to induce a protective immune response against the chicken disease avian coccidiosis, caused by the intestinal parasite Eimeria acervulina. However, since the amount of antibodies secreted from these hybridomas is too low or sometimes they lost their ability to produce antibodies, the hybridoma method is not satisfactory in the production of large amounts of chicken monoclonal antibodies. To bypass these problems, we applied the antibody engineering technology using polymerase chain reaction. We cloned and determined the sequences of variable domains of the four chicken monoclonal antibodies, namely, 2-1, 5D11, 13C8 and 8C3. The sequences comparison to germline sequences showed that the gene conversion mechanism might contribute to developing diversification of heavy and l-light chains in chicken antibodies. Several pseudogene families regarded as donors in gene conversion were identified at each framework region and the complementarity determining region of l-light chains. In addition, as expected, numerous changes of nucleotide sequences such as nucleotide substitution, insertion and deletion were found predominantly in complementarity determining regions, which are likely to be somatic hypermutations as a result of affinity maturation in antibody-producing cells.
Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae
Hee Jong Kim , Youn Su Lee
J. Microbiol. 2001;39(1):56-61.
  • 332 View
  • 0 Download
AbstractAbstract PDF
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set from the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCTTTGA (PB-2). This primer set was used to specifically detect P. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia spp., as well as bacteria such as Pseudomonas spp. and Erwinia spp. did not show any reaction with the primer set.
Concentration of CCCP Should Be Optimized to Detect the Efflux System in Quinolone-Susceptible Escherichia coli
Hyengun Cho , Yoojung Oh , Seohyung Park , Yeonhee Lee
J. Microbiol. 2001;39(1):62-66.
  • 347 View
  • 0 Download
AbstractAbstract PDF
Unlike eukaryotic efflux pumps energized by ATPase, bacterial efflux pumps are energized by the proton motive force. That is the reason why CCCP, an inhibitor of proton motive force, is widely used to study the bacterial efflux pump. In many cases, efflux systems have been observed only in quinoloneresistant bacteria. Most of the quinolone-susceptible strains have been found to maintain little efflux pump. However, some susceptible bacteria showed the increased intracellular quinolone concentration only at a low concentration (0.01 or 0.1 mM) but not at a high concentration (1 mM) of CCCP. If bacterial cells were killed at high concentrations of CCCP and lost the integrity of their membranes, the intracellular quinolone would leak out from cells with no efflux system. The efflux pump system in the quinolone-susceptible strains could not be detected at the same concentration used for sistant bacteria. To test this hypothesis, the intracellular quinolone concentration in the quinolone-susceptible and -resistant strains of Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus was assayed at various concentrations of CCCP. Since the effect of CCCP is very rapid, the survival of bacteria was observed by assaying the DNA synthesis in 5 min. In the case of E. coli, but not P. aeruginosa or S. aureus, the quinolone susceptible strain was more susceptible to CCCP than the quinolone resistant ones, especially when the incubation with CCCP was extended. Decrease of the intracellular quinolone concentration resulted in a false result-no or weak efflux system in the quinolone susceptible strains. Results suggested that the concentration of CCCP should be optimized in order to detect the efflux system in the quinolone susceptible strains of E. coli.
Removal and Inactivation of Hepatitis A Virus during Manufacture of a High Purity Antihemophilic Factor VIII Concentrate from Human Plasma
In Seop Kim , Yong Woon Choi , Sung Rae Lee , Mahl Soon Lee , Ki Ho Huh , Soungmin Lee
J. Microbiol. 2001;39(1):67-73.
  • 365 View
  • 1 Download
AbstractAbstract PDF
A validation study was conducted to evaluate the efficacy and mechanism of the cryo-precipitation, monoclonal anti-FVIIIc antibody (mAb) chromatography, Q-Sepharose chromatography, and lyophilization steps involved in the manufacture of high purity factor VIII (GreenMono) from human plasma, in the removal and/or inactivation of hepatitis A virus (HAV). Samples from the relevant stages of the production process were spiked with HAV and subjected to scale-down processes mimicking the manufacture of the high purity factor VIII concentrate. Samples were collected at each step and immediately titrated using a 50% tissue culture infectious dose (TCID50) and then the virus reduction factors were evaluated. HAV was effectively partitioned from factor VIII during cryo-precipitation with the log reduction factor of 3.2. The mAb chromatography was the most effective step for removal of HAV with the log reduction factor of ³4.3. HAV infectivity was not detected in the fraction of factor VIII, while most of HAV infectivity was recovered in the fractions of flow through and wash during mAb chromatography. Q-Sepharose chromatography showed the lowest efficacy for partitioning HAV with the log reduction factor of 0.7. Lyophilization was an effective step in inactivating HAV with the log reduction factor of 2.3. The cumulative log reduction factor, ³10.5, achieved for the entire manufacturing process was several magnitudes greater than the potential HAV load of current plasma pools.
Cell Cycle-dependent Expression of Chitin Synthase Genes in Aspergillus nidulans
Bum-Chan Park , Pil-Jae Maeng , Hee-Moon Park
J. Microbiol. 2001;39(1):74-78.
  • 314 View
  • 0 Download
AbstractAbstract PDF
The transcription of the chitin synthase genes (chss) was cell cycle-regulated in Aspergillus nidulans and the expression pattern was classified into two groups. Group one, containing chsA and chsC, showed decreasing transcription level upon entry into the S-phase and no further variation during the remainder of the cell cycle. However, group two, containing chsB, chsD, and csmA, showed a sharp decrease of mRNA level upon entry into the G2-phase and an increase during the M-phase. Our results suggested that the chss, belonging to same group with the similar expression pattern during the cell cycle are functionally linked and that chsD may play a role in hyphal growth and development in A. nidulans.
Effect of Levulinic Acid on the Production of Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) by Ralstonia eutropha KHB-8862
Sun Ho Chung , Gang Guk Choi , Hyung Woo Kim , Young Ha Rhee
J. Microbiol. 2001;39(1):79-82.
  • 335 View
  • 1 Download
AbstractAbstract PDF
The influence of levulinic acid (LA) on the production of copolyester consisting of 3-hydroxybutyrate (3HB) and 3-hydroxyvalerate (3HV) by Ralstonia eutropha was investigated. Addition of LA into the culture medium greatly increased the molar fraction of 3HV in the copolyester, indicating that LA can be utilized as a precursor of 3HV. In shake flask culture, the 3HV content in the copolyester increased from 7 to 75 mol% by adding 0.5 to 4.0 g/L LA to the medium containing fructose syrup as a main carbon source. A maximal copolyester concentration of 3.6 g/L (69% of dry cell weight) was achieved with a 3HV content of 40 mol% in a jar fermentor culture containing 4.0 g/L of LA. When LA (total concentration, 4 g/L) was added repeatedly into a fermentor culture to maintain its concentration at a low level, the copolyester content and the 3HV yield from LA reached up to 85% of dry cell weight and 5.0 g/g, respectively, which were significantly higher than those when the same concentration of the LA was supplied all at once. The present results indicated that LA is more effective than propionate or valerate as a cosubstrate for the production of copolyesters with varying molar fractions of 3HV by R. eutropha.

Journal of Microbiology : Journal of Microbiology
TOP