Journal of Microbiology

Research Support, Non-U.S. Gov'ts

Diversity of indigenous endophytic bacteria associated with the roots of Chinese cabbage (Brassica campestris L.) cultivars and their antagonism towards pathogens: Md. Azizul Haque , Han Dae Yun , Kye Man Cho; J. Microbiol. 2016;54(5):353-363. Published online April 20, 2016; DOI: https://doi.org/10.1007/s12275-016-5641-7

10 View
0 Download
17 Citations

Abstract: The study aimed to reveal the diversity of endophytic bacteria in the roots of Chinese cabbage (CC) cultivated in two areas in Korea, namely, Seosang-gun (SS) and Haenam-gun (HN), and also in a transgenic plant (TP) from the laboratory. A total of 653 colonies were isolated from the interior of CC roots, comprising 118, 302, and 233 isolates from SS, HN, and TP samples, respectively. Based on 16S rRNA gene sequence analysis, the isolates belonged to four major phylogenetic groups: high-G+C Gram-positive bacteria (HGC-GPB), low-G+C Gram-positive bacteria (LGC-GPB), Proteobacteria, and Bacteriodetes. The most dominant groups in the roots of the SS, HN, and TP cultivars were LGC-GPB (48.3%), Proteobacteria (50.2%), and HGC-GPB (38.2%), respectively. Importantly, most of the isolates that produced cell-walldegrading enzymes belonged to the genus Bacillus. Bacillus sp. (HNR03, TPR06), Bacillus pumilus (SSR07, HNR11, TPR07), and Bacillus subtilis (TPR03) showed high antagonism against the tested food-borne pathogenic bacteria. In addition, Bacillus sp. (HNR03, TPR06), Bacillus pumilus (SSR07, HNR11, HNR17, TPR11), Microbacterium oxidans (SSR09, TPR04), Bacillus cereus HNR10, Pseudomonas sp. HNR13, and Bacillus subtilis (TPR02, TPR03) showed strong antagonistic activity against the fungi Phythium ultimum, Phytophthora capsici, Fusarium oxysporum, and Rhizoctonia solani. The endophytes isolated from the TP cultivar showed the strongest antagonistic reactions against pathogens. This study is the first report on endophytic bacteria from Chinese cabbage roots.

Pedobacter namyangjuensis sp. nov. Isolated from Soil and Reclassification of Nubsella zeaxanthinifaciens Asker et al. 2008 as Pedobacter zeaxanthinifaciens comb. nov.: Dong-Uk Kim , Yoo-Jeong Kim , Dong-Hyeon Shin , Hang-Yeon Weon , Soon-Wo Kwon , Chi-Nam Seong , Jong-Ok Ka; J. Microbiol. 2013;51(1):25-30. Published online March 2, 2013; DOI: https://doi.org/10.1007/s12275-013-2231-9

13 View
0 Download
15 Citations

Abstract: A Gram-stain-negative, non-motile, strictly aerobic, yellowpigmented bacterium, designated strain 5G38T, was isolated from a field cultivated with Chinese cabbage in Korea. The strain grew at 5–40°C and at pH 6.0–8.0. 16S rRNA gene sequence analysis revealed that strain 5G38T represented a distinct lineage within the family Sphingobacteriaceae and showed the highest 16S rRNA gene sequence similarity of 95.2% with Pedobacter koreensis WPCB189T, followed by Pedobacter agri PB92T (94.6%), Pedobacter suwonensis 15-52T (94.4%), Pedobacter rhizosphaerae 01-96T (94.4%), Pedobacter sandarakinus DS-27T (94.4%), and Nubsella zeaxanthinifaciens TDMA-5T (94.3%). Strain 5G38T formed monophyletic clade with Nubsella zeaxanthinifaciens in the cluster comprised of species of the genus Pedobacter. Chemotaxonomic characteristics of the novel strains, including DNA G+C content of genomic DNA (37.0 mol%), the predominant respiratory quinine (MK-7), and the major fatty acids which were iso-C15:0, summed feature 3 (comprising C16:1ω7c and/or iso-C15:0 2-OH) and iso-C17:0 3-OH, are similar to those of the genus Pedobacter. However, the novel strains can be distinguished from the other species of Pedobacter by physiological properties. The name Pedobacter namyangjuensis sp. nov. is therefore proposed for strain 5G38T (KACC 13938T =NBRC 107692T) as the type strain. Furthermore, the reclassification of Nubsella zeaxanthinifaciens as Pedobacter zeaxanthinifaciens comb. nov. is proposed.

Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae: Hee Jong Kim , Youn Su Lee; J. Microbiol. 2001;39(1):56-61.

12 View
0 Download

Abstract: Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set from the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCTTTGA (PB-2). This primer set was used to specifically detect P. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia spp., as well as bacteria such as Pseudomonas spp. and Erwinia spp. did not show any reaction with the primer set.

First
Prev
Page of 1
Next
Last

Search