Journal Article
- Dynamics of Microbial Community Structure, Function and Assembly Mechanism with Increasing Stand Age of Slash Pine (Pinus elliottii) Plantations in Houtian Sandy Area, South China
-
Xiaoyang Zhang , Si-Yi Xiong , Xiukun Wu , Bei-Bei Zeng , Yang-Mei Mo , Zhi-Cheng Deng , Qi Wei , Yang Gao , Licao Cui , Jianping Liu , Haozhi Long
-
J. Microbiol. 2023;61(11):953-966. Published online November 29, 2023
-
DOI: https://doi.org/10.1007/s12275-023-00089-7
-
-
95
View
-
0
Download
-
4
Web of Science
-
5
Crossref
-
Abstract
-
Establishing slash pine plantations is the primary method for restoring sandification land in the Houtian area of South China.
However, the microbial variation pattern with increasing stand age remains unclear. In this study, we investigated microbial
community structure and function in bare sandy land and four stand age gradients, exploring ecological processes that
determine their assembly. We did not observe a significant increase in the absolute abundance of bacteria or fungi with stand
age. Bacterial communities were dominated by Chloroflexi, Actinobacteria, Proteobacteria, and Acidobacteria; the relative
abundance of Chloroflexi significantly declined while Proteobacteria and Acidobacteria significantly increased with stand
age. Fungal communities showed succession at the genus level, with Pisolithus most abundant in soils of younger stands
(1- and 6-year-old). Turnover of fungal communities was primarily driven by stochastic processes; both deterministic and
stochastic processes influenced the assembly of bacterial communities, with the relative importance of stochastic processes
gradually increasing with stand age. Bacterial and fungal communities showed the strongest correlation with the diameter
at breast height, followed by soil available phosphorus and water content. Notably, there was a significant increase in the
relative abundance of functional groups involved in nitrogen fixation and uptake as stand age increased. Overall, this study
highlights the important effects of slash pine stand age on microbial communities in sandy lands and suggests attention to
the nitrogen and phosphorus requirements of slash pine plantations in the later stages of sandy management.
-
Citations
Citations to this article as recorded by

- Assembly processes and networks of soil microbial communities along karst forest succession
Wanxia Peng, Min Song, Hu Du, Shanghua Jiang, Fuping Zeng, Huijun Chen, Tongqing Song
CATENA.2025; 248: 108574. CrossRef - Temporal dynamics of soil microbial symbioses in the root zone of wolfberry: deciphering the effects of biotic and abiotic factors on bacterial and fungal ecological networks
Mengyuan He, Qianqian Wang, Yiming Wang, Junhua Zhang
Frontiers in Plant Science.2025;[Epub] CrossRef - Assessing the health of climate-sensitive trees in a subalpine ecosystem through microbial community dynamics
Bo Ram Kang, Soo Bin Kim, Jin-Kyung Hong, Seok Hyun Ahn, Jinwon Kim, Nayeon Lee, Tae Kwon Lee
Science of The Total Environment.2024; 957: 177724. CrossRef - The complex relationships between diatoms, bacterial communities, and dissolved organic matter: Effects of silicon concentration
Xiding Wang, Yang Liu, Yi Zhang, Peng Wu, Xudong Liu, Fangru Nan, Qi Liu, Junping Lv, Jia Feng, Shulian Xie
Algal Research.2024; 79: 103460. CrossRef - Assembly and co-occurrence pattern of microbial communities in bulk and rhizosphere soils of Pinus elliottii plantations on sandy lands in China
Haozhi Long, Si-Yi Xiong, Yang-Mei Mo, Bei-Bei Zeng, Bin-Xuan Shan, Ting Xiao, Yang Gao, Chaoyu Cui
Plant and Soil.2024;[Epub] CrossRef
Review
- Temperature Matters: Bacterial Response to Temperature Change
-
Seongjoon Moon , Soojeong Ham , Juwon Jeong , Heechan Ku , Hyunhee Kim , Changhan Lee
-
J. Microbiol. 2023;61(3):343-357. Published online April 3, 2023
-
DOI: https://doi.org/10.1007/s12275-023-00031-x
-
-
411
View
-
0
Download
-
32
Web of Science
-
33
Crossref
-
Abstract
-
Temperature is one of the most important factors in all living organisms for survival. Being a unicellular organism, bacterium
requires sensitive sensing and defense mechanisms to tolerate changes in temperature. During a temperature shift,
the structure and composition of various cellular molecules including nucleic acids, proteins, and membranes are affected.
In addition, numerous genes are induced during heat or cold shocks to overcome the cellular stresses, which are known as
heat- and cold-shock proteins. In this review, we describe the cellular phenomena that occur with temperature change and
bacterial responses from a molecular perspective, mainly in Escherichia coli.
-
Citations
Citations to this article as recorded by

- The bacterial assemblage in the plumage of the Violet-crowned Hummingbird (Ramosomyia violiceps) varies with contrasting environments in Central-Western Mexico
Lizeth Raygoza-Alcantar, Verónica Rosas-Espinoza, Fabián Rodríguez-Zaragoza, María E. Macías-Rodríguez, Flor Rodríguez-Gómez
Journal of Ornithology.2025; 166(2): 525. CrossRef - Onion-like carbon based single-atom iron nanozyme for photothermal and catalytic synergistic antibacterial application
Yuchen Feng, Yuxi Shi, Qi Zhao, Guanyue Gao, Zhiqiang Wang, Jinfang Zhi
Journal of Colloid and Interface Science.2025; 681: 205. CrossRef - Regulation and response of heterotrophic bacterial production to environmental changes in marginal seas of the Western Pacific Ocean
Qiao Liu, Jinyan Wang, Xiao-Jun Li, Ni Meng, Gui-Peng Yang, Guiling Zhang, Guang-Chao Zhuang
Global and Planetary Change.2025; 245: 104678. CrossRef - Quality effects of sodium alginate coating cross-linked with CaCl2 on Mugil liza fillets during storage
Márcio Vargas-Ramella, Débora da Silva, Guilherme Dilarri, Antonella Valentina Lazzari Zortea, Carolina Rosai Mendes, Gabriel de Souza Laurentino, Paulo Cezar Bastianello Campagnol, Aline Fernandes de Oliveira, Cristian Berto da Silveira
Food Control.2025; 170: 111048. CrossRef - Decoding bacterial communication: Intracellular signal transduction, quorum sensing, and cross-kingdom interactions
Shuxun Liu, Xujie Feng, Hangjia Zhang, Ping Li, Baoru Yang, Qing Gu
Microbiological Research.2025; 292: 127995. CrossRef - Soil Organic Matter and Total Nitrogen Reshaped Root-Associated Bacteria Community and Synergistic Change the Stress Resistance of Codonopsis pilosula
Xiaokang Huo, Yumeng Zhou, Ning Zhu, Xiaopeng Guo, Wen Luo, Yan Zhuang, Feifan Leng, Yonggang Wang
Molecular Biotechnology.2025; 67(6): 2545. CrossRef - Seasonal variations in physicochemical properties, volatile compounds, and microbial community structure of Dajiang fermented using a semi-controlled method
Xiaojing Zhang, Qiqi Xiao, Xin Wang, Zhehao Zhang, Tao Guo, Bin Wang, Yanshun Xu
Food Bioscience.2025; 63: 105791. CrossRef - Lipid Production in Streptomyces jeddahensis Is Enhanced by Glucose and Fatty Acid Derivatives, with Temperature Variations Influencing Gene Expression and Biosynthesis
Pamella Apriliana, Prihardi Kahar, Nova Rachmadona, Witta Kartika Restu, Akihiko Kondo, Chiaki Ogino
Fermentation.2025; 11(2): 45. CrossRef - Mechanisms of anammox bacteria adaptation to high temperatures: Increased content of bi-ladderane lipids and proteomic insights
Karmann Christina, Navrátilová Klára, Behner Adam, Noor Tayyaba, Danner Stella, Majchrzak Anastasia, Šantrůček Jiří, Podzimek Tomáš, Lopez Marin Marco A., Hajšlová Jana, Lipovová Petra, Bartáček Jan, Kouba Vojtěch
Journal of Environmental Chemical Engineering.2025; 13(2): 115628. CrossRef - Synergistic effects of indigenous bacterial consortia on heavy metal tolerance and reduction
Rahel Khidr, Karzan Qurbani, Vania Muhammed, Sazgar Salim, Shajwan Abdulla, Hevy Wsw
Environmental Geochemistry and Health.2025;[Epub] CrossRef - Physical communication pathways in bacteria: an extra layer to quorum sensing
Virgilio de la Viuda, Javier Buceta, Iago Grobas
Biophysical Reviews.2025; 17(2): 667. CrossRef - Survival characteristics of vancomycin-resistant Enterococcus isolated from sludge compost under heat and drying stress: Implications for pathogen inactivation during composting
Bingni Zhang, Feiyu Wang, Chaofeng Shen
Environment International.2025; 198: 109464. CrossRef - Characterization of a rapid 17β-estradiol-degrading strain, Microbacterium proteolyticum ZJSU01
Yipeng Chen, Ting Chen, Wenfeng Xu, Xiaoqin Yu, Xiujuan Tang, Ying Wang, Jun Yin
Applied Microbiology and Biotechnology.2025;[Epub] CrossRef - Photocatalytic effect of gold-zinc oxide composite nanostructures for the selective and controlled killing of antibiotic-resistant bacteria and the removal of resistant bacterial biofilms from the body
Jongjun Park, Tae Hui Bae, Su Yong Kim, Seongeun Park, Yonghyun Choi, Masayoshi Tanaka, Jiwon Kim, Jaehee Jang, Jihyuk Yang, Hee-Young Lee, Tagbo H. R. Niepa, Shin Hyuk Kang, Jonghoon Choi
Nano Convergence.2025;[Epub] CrossRef - Sodium alginate-based photothermal film: Preparation, antibacterial activity, and application for preservation of Kyoho Grapes
Zihan Hou, Yunxiao Xia, Yuan Sun, Ming Yang, Lingling Wang, Weizhuo Xu, Xu Zhao
Journal of Future Foods.2025;[Epub] CrossRef - Influence of hydrogen peroxide on heterotrophic communities in ammonia-oxidizing enrichment cultures
Madisen P Kimbrel, Madelynn D Spencer, Annette Bollmann
Aquatic Microbial Ecology.2025; 91: 53. CrossRef - Microalgal-bacterial consortia for the treatment of livestock wastewater: Removal of pollutants, interaction mechanisms, influencing factors, and prospects for application
KhinKhin Phyu, Suli Zhi, Junfeng Liang, Chein-Chi Chang, Jiahua Liu, Yuang Cao, Han Wang, Keqiang Zhang
Environmental Pollution.2024; 349: 123864. CrossRef - Laser NIR Irradiation Enhances Antimicrobial Photodynamic Inactivation of Biofilms of Staphylococcus aureus
Leandro Mamone, Roberto Tomás, Gabriela Di Venosa, Lautaro Gándara, Edgardo Durantini, Fernanda Buzzola, Adriana Casas
Lasers in Surgery and Medicine.2024; 56(9): 783. CrossRef - Comparison of Incubation Conditions for Microbial Contaminant Isolation in Microbiological Environmental Monitoring
O. V. Gunar, N. G. Sakhno, O. S. Tyncherova
Regulatory Research and Medicine Evaluation.2024; 14(4): 483. CrossRef - Molecular insights and functional analysis of isocitrate dehydrogenase in two gram-negative pathogenic bacteria
Wei Xiong, Rui Su, Xueyang Han, Mengxiao Zhu, Hongyiru Tang, Shiping Huang, Peng Wang, Guoping Zhu
World Journal of Microbiology and Biotechnology.2024;[Epub] CrossRef -
The transcriptional response to low temperature is weakly conserved across the
Enterobacteriaceae
Johnson Hoang, Daniel M. Stoebel, Sarah L. Svensson
mSystems.2024;[Epub] CrossRef - A newly isolated strain for poly(3-hydroxybutyrate) production under anaerobic conditions and the key enzyme analysis
Rui Ma, Ji Li, R.D. Tyagi, Xiaolei Zhang
Chemical Engineering Journal.2024; 496: 154200. CrossRef - Construction of a tertiary model and uncertainty analysis for the effect of time, temperature, available chlorine concentration of slightly acidic electrolyzed water on salmonella enteritidis and background total bacteria counts on chicken
Yao Zang, Yitian Zang, Qiang Zhang, Guosheng Zhang, Jie Hu, Renxin Liu, Mingming Tu, Wenduo Qiao, Mengzhen Hu, Boya Fu, Dengqun Shu, Yanjiao Li, Xianghui Zhao
LWT.2024; 214: 117166. CrossRef - Assimilatory sulphate reduction by acidogenesis: The key to prevent H2S formation during food and green waste composting for sustainable urbanization
Xingzu Gao, Zhicheng Xu, Lanxia Zhang, Guoxue Li, Long D. Nghiem, Wenhai Luo
Chemical Engineering Journal.2024; 499: 156149. CrossRef -
A riboswitch-controlled TerC family transporter Alx tunes intracellular manganese concentration in
Escherichia coli
at alkaline pH
Ravish Sharma, Tatiana V. Mishanina, Conrad W. Mullineaux
Journal of Bacteriology.2024;[Epub] CrossRef - Assessing the health of climate-sensitive trees in a subalpine ecosystem through microbial community dynamics
Bo Ram Kang, Soo Bin Kim, Jin-Kyung Hong, Seok Hyun Ahn, Jinwon Kim, Nayeon Lee, Tae Kwon Lee
Science of The Total Environment.2024; 957: 177724. CrossRef - Enhancing polycyclic aromatic hydrocarbon soil remediation in cold climates using immobilized low-temperature-resistant mixed microorganisms
Dan Su, YiHan Liu, FengFei Liu, YuShan Dong, Yu Pu
Science of The Total Environment.2024; 939: 173414. CrossRef - Investigating Escherichia coli habitat transition from sediments to water in tropical urban lakes
Boyu Liu, Choon Weng Lee, Chui Wei Bong, Ai-Jun Wang
PeerJ.2024; 12: e16556. CrossRef - Bacterial bioaugmentation for paracetamol removal from water and sewage sludge. Genomic approaches to elucidate biodegradation pathway
A. Lara-Moreno, A. Vargas-Ordóñez, J. Villaverde, F. Madrid, J.D. Carlier, J.L. Santos, E. Alonso, E. Morillo
Journal of Hazardous Materials.2024; 480: 136128. CrossRef - Dietary supplementation with host-associated low-temperature potential probiotics improves the growth, immunity, digestive enzyme activity, and intestinal microbial population of olive flounder (Paralichthys olivaceus)
Su-Jeong Lee, Young-Sun Lee, Da-In Noh, Md Tawheed Hasan, Sang Woo Hur, Seunghan Lee, Seong-Mok Jeong, Kang-Woong Kim, Jong Min Lee, Eun-Woo Lee, Won Je Jang
Aquaculture Reports.2024; 36: 102128. CrossRef - Global biochemical profiling of fast-growing Antarctic bacteria isolated from meltwater ponds by high-throughput FTIR spectroscopy
Volha Akulava, Valeria Tafintseva, Uladzislau Blazhko, Achim Kohler, Uladzislau Miamin, Leonid Valentovich, Volha Shapaval, Marcos Pileggi
PLOS ONE.2024; 19(6): e0303298. CrossRef - Phyletic patterns of bacterial growth temperature in Pseudomonas and Paenibacillus reveal gradual and sporadic evolution towards cold adaptation
Kihyun Lee, Seong-Hyeon Kim, Seongjoon Moon, Sangha Kim, Changhan Lee
ISME Communications.2024;[Epub] CrossRef - Bacterial Regulatory Mechanisms for the Control of Cellular Processes: Simple Organisms’ Complex Regulation
Jin-Won Lee
Journal of Microbiology.2023; 61(3): 273. CrossRef
Journal Article
- Autoinducer-2 detection among commensal oral streptococci is dependent on pH and boric acid
-
Giancarlo A. Cuadra , Ashley J. Frantellizzi , Kimberly M. Gaesser , Steven P. Tammariello , Anika Ahmed
-
J. Microbiol. 2016;54(7):492-502. Published online June 28, 2016
-
DOI: https://doi.org/10.1007/s12275-016-5507-z
-
-
61
View
-
0
Download
-
5
Crossref
-
Abstract
-
Autoinducer-2, considered a universal signaling molecule, is
produced by many species of bacteria; including oral strains.
Structurally, autoinducer-2 can exist bound to boron (borated
autoinducer-2). Functionally, autoinducer-2 has been linked
to important bacterial processes such as virulence and biofilm
formation. In order to test production of autoinducer-2 by a
given bacterial strain, a bioassay using marine bioluminescent
bacteria Vibrio harveyi as a reporter for autoinducer-2
has been designed. We hypothesize that pH adjustment and
addition of boron are required for optimal bioluminescence
and accurate autoinducer-2 detection. Using this reporter
strain we tested autoinducer-2 activity from two oral commensal
species, Streptococcus gordonii DL1 and Streptococcus
oralis 34. Spent broth was collected and adjusted to pH 7.5
and supplemented with boric acid prior to measuring autoinducer-
2 activity. Results show that low pH inhibits bioluminescence
of the reporter strain, but pH 7.5 allows for bioluminescence
induction and proper readings of autoinducer-2
activity. Addition of boric acid also has a positive effect on
bioluminescence allowing for a more sensitive detection of
autoinducer-2 activity. Our data suggests that although autoinducer-
2 is present in spent broth, low pH and/or low levels
of boric acid become an obstacle for proper autoinducer-2
detection. For proper autoinducer-2 detection, we propose a
protocol using this bioassay to include pH adjustment and
boric acid addition to spent broth. Studies on autoinducer-2
activity in several bacteria species represent an important area
of study as this universal signaling molecule is involved in
critical bacterial phenotypes such as virulence and biofilm
formation.
-
Citations
Citations to this article as recorded by

- Inhibitory effect of Lonicera japonica flos on Streptococcus mutans biofilm and mechanism exploration through metabolomic and transcriptomic analyses
Lin Wang, Ping Liu, Yulun Wu, Hairun Pei, Xueli Cao
Frontiers in Microbiology.2024;[Epub] CrossRef - New Insights into Boron Essentiality in Humans and Animals
Andrei Biţă, Ion Romulus Scorei, Tudor Adrian Bălşeanu, Maria Viorica Ciocîlteu, Cornelia Bejenaru, Antonia Radu, Ludovic Everard Bejenaru, Gabriela Rău, George Dan Mogoşanu, Johny Neamţu, Steven A. Benner
International Journal of Molecular Sciences.2022; 23(16): 9147. CrossRef - Exogenous autoinducer-2 inhibits biofilm development of Desulfovibrio sp. Huiquan2017
Ee Li, Jiajia Wu, Dun Zhang
World Journal of Microbiology and Biotechnology.2021;[Epub] CrossRef - Efficacy of Preprocedural Boric Acid Mouthrinse in Reducing Viable Bacteria in Dental Aerosols Produced during Ultrasonic Scaling
Swet Nisha, Avinash Bettahalli Shivamallu, Sheela Kumar Gujjari, Pratibha Shashikumar, Nada Musharraf Ali, Madhuri Kulkarni
Contemporary Clinical Dentistry.2021; 12(3): 282. CrossRef - D-Ribose Interferes with Quorum Sensing to Inhibit Biofilm Formation of Lactobacillus paraplantarum L-ZS9
Lei Liu, Ruiyun Wu, Jinlan Zhang, Nan Shang, Pinglan Li
Frontiers in Microbiology.2017;[Epub] CrossRef
Research Support, Non-U.S. Gov'ts
- Isolation and Characterization of a Mycovirus in Lentinula edodes
-
Hyo-Kyoung Won , So-Jung Park , Dong-Kyu Kim , Myeung Ju Shin , Nari Kim , Song-Hee Lee , Young-Chul Kwon , Han Kyu Ko , Hyeon-Su Ro , Hyun-Sook Lee
-
J. Microbiol. 2013;51(1):118-122. Published online March 2, 2013
-
DOI: https://doi.org/10.1007/s12275-013-2351-2
-
-
39
View
-
0
Download
-
31
Scopus
-
Abstract
-
A mycovirus was isolated from an edible mushroom, Lentinula edodes, that was suffering from a severe epidemic. Fractionation of the diseased cell extract by isopycnic centrifugation with 50% CsCl revealed that the diseased mushroom was infected by Lentinula edodes spherical virus (LeSV), a new spherical virus with a diameter of 55 nm. The particle of LeSV encapsidated the 12 kb RNA genome by a 120 kDa coat protein. BLAST analysis of the partially sequenced LeSV genome showed 95% sequence identity with a putative RNAdependent RNA polymerase (RdRp) gene of the mycovirus HKB, which was previously reported as being a doublestranded RNA (dsRNA) element. In contrast to HKB, the RNA genome in LeSV is encapsidated by the 120 kDa coat protein. To confirm that the LeSV coat protein is encoded by the viral genome, the N-terminal amino acid sequence of the coat protein was determined. The resulting N-terminal amino acid sequence, N-SALDVAPVVPELYFXXLEV-C, was found to be located in the middle of the HKB ORF1, suggesting that the LeSV coat protein was indeed encoded by the virus. To detect LeSV in L. edodes, a primer set targeting the RdRp gene was designed based on the partial sequence of the LeSV genome. RT-PCR analysis showed that 56 of the 84 commercially available dikaryotic cultivars carry LeSV. The transmission pattern of the virus was determined by analysing basidiospores from LeSV-infected and LeSVfree fruiting bodies. Nine out of 10 basidiospores from the LeSV-infected cultivars contained the virus while the spores from the LeSV-free parent were free of LeSV, suggesting that vertical transmission is the primary mode of LeSV propagation.
- Development of SCAR Primers Based on a Repetitive DNA Fingerprint for Escherichia coli Detection
-
Aphidech Sangdee , Sitakan Natphosuk , Adunwit Srisathan , Kusavadee Sangdee
-
J. Microbiol. 2013;51(1):31-35. Published online March 2, 2013
-
DOI: https://doi.org/10.1007/s12275-013-2244-4
-
-
52
View
-
0
Download
-
4
Scopus
-
Abstract
-
The present study aimed to use enterobacterial repetitive intergenic consensus (ERIC) fingerprints to design SCAR primers for the detection of Escherichia coli. The E. coli strains were isolated from various water sources. The primary presumptive identification of E. coli was achieved using MacConkey agar. Nineteen isolates were selected and confirmed to be E. coli strains based on seven biochemical characteristics. ERIC-PCR with ERIC 1R and ERIC 2 primers were used to generate DNA fingerprints. ERIC-PCR DNA profiles showed variant DNA profiles among the tested E. coli strains and distinguished all E. coli strains from the other tested bacterial strains. A 350 bp band that predominated in five E. coli strains was used for the development of the species-specific SCAR primers EC-F1 and EC-R1. The primers showed good specificity for E. coli, with the exception of a single false positive reaction with Sh. flexneri DMST 4423. The primers were able to detect 50 pg and 100 CFU/ml of genomic DNA and cells of E. coli, respectively.
- A Quantitative and Direct PCR Assay for the Subspecies-Specific Detection of Clavibacter michiganensis subsp. michiganensis Based on a Ferredoxin Reductase Gene
-
Min Seok Cho , Jang Ha Lee , Nam Han Her , ChangKug Kim , Young-Joo Seol , Jang Ho Hahn , Ji Hyoun Baeg , Hong Gi Kim , Dong Suk Park
-
J. Microbiol. 2012;50(3):496-501. Published online June 30, 2012
-
DOI: https://doi.org/10.1007/s12275-012-1611-x
-
-
40
View
-
0
Download
-
3
Scopus
-
Abstract
-
The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.
- NOTE] Diversity Analysis of Burkholderia cepacia Complex in the Water Bodies of West Lake, Hangzhou, China
-
Yuan Fang , Guan-lin Xie , Miao-miao Lou , Bin Li , Ibrahim Muhammad
-
J. Microbiol. 2011;49(2):309-314. Published online May 3, 2011
-
DOI: https://doi.org/10.1007/s12275-011-0267-2
-
-
35
View
-
0
Download
-
12
Scopus
-
Abstract
-
A survey of Burkholderia cepacia complex (Bcc) species was conducted in water bodies of West Lake in China. A total of 670 bacterial isolates were recovered on selective media. Out of them, 39.6% (265 isolates) were assigned to the following species: Burkholderia multivorans, Burkholderia cenocepacia recA lineage IIIA,
IIIB, Burkholderia stabilis, Burkholderia vietnamiensis, and Burkholderia seminalis while B. cenocepacia is documented as a dominant Bcc species in water of West Lake. In addition, all Bcc isolates tested were PCR negative for the cblA and esmR transmissibility marker genes except B. cenocepacia IIIB A8 which was positive for esmR genelater. The present study raises great concerns on the role of West Lake as a “reservoir” for potential Bcc pathogenic strains.
- Detection of Xanthomonas arboricola pv. pruni by PCR Using Primers Based on DNA Sequences Related to the hrp Genes
-
So Yeon Park , Young Sun Lee , Young Jin Koh , Jae-Sun Hur , Jae Sung Jung
-
J. Microbiol. 2010;48(5):554-558. Published online November 3, 2010
-
DOI: https://doi.org/10.1007/s12275-010-0072-3
-
-
48
View
-
0
Download
-
14
Crossref
-
Abstract
-
Efficient control of Xanthomonas arboricola pv. pruni, the causal agent of bacterial spot on stone fruit, requires a sensitive and reliable diagnostic tool. A PCR detection method that utilizes primers to target the hrp gene cluster region was developed in this study. The nucleotide sequence of the PCR product amplified with primers specific for the hrp region of the xanthomonads and genomic DNA of X. arboricola pv. pruni was determined, and the sequence was aligned with that of X. campestris pv. campestris, which was obtained from the GenBank database. On the basis of the sequence of the amplified hrp region, a PCR primer set of XapF/R specific to X. arboricola pv. pruni was designed. This primer set yielded a 243-bp product from the genomic DNA of X. aboricola pv. pruni strains, but no products from other 21 strains of Xanthomonas or from two epiphytic bacterial species. Southern blot hybridization with the probe derived from the PCR product with the primer set and X. aboricola pv. pruni DNA confirmed the PCR results. The Xap primer system was successfully applied to detect the pathogen from infected peach fruits. When it was applied in field samples, the primer set was proved as a reliable diagnostic tool for specific detection of X. aboricola pv. pruni from peach orchards.
-
Citations
Citations to this article as recorded by

- Advancing Sustainable Management of Bacterial Spot of Peaches: Insights into Xanthomonas arboricola pv. pruni Pathogenicity and Control Strategies
Nanami Sakata, Yasuhiro Ishiga
Bacteria.2025; 4(2): 27. CrossRef - Multiplex lateral flow immunoassay for simultaneous detection and specific discrimination of Xoo and Xoc in rice plants
Cui Zhang, Xi Zhang, Nairu Liu, Jie Dong, Weijia Mao, Zhaoli Liu, Xueping Zhou, Jianxiang Wu
Talanta.2025; 292: 127917. CrossRef - Development of a Long-Amplicon Propidium Monoazide–Quantitative PCR Assay for Detection of Viable Xanthomonas arboricola pv. pruni Cells in Peach Trees
Milan Panth, Enoch Noh, Guido Schnabel, Hehe Wang
Plant Disease.2024; 108(7): 2190. CrossRef - Selection of target genes for pcr diagnostics of Xanthomonas arboricola virulent for cereals and brassicas
E. I. Kyrova*, A. N. Ignatov
PLANT PROTECTION NEWS.2021; 104(2): 87. CrossRef - Recombinase Polymerase Amplification/Cas12a-Based Identification of Xanthomonas arboricola pv. pruni on Peach
Mei Luo, Fan-Zhu Meng, Qin Tan, Wei-Xiao Yin, Chao-Xi Luo
Frontiers in Plant Science.2021;[Epub] CrossRef - Trends in Molecular Diagnosis and Diversity Studies for Phytosanitary Regulated Xanthomonas
Vittoria Catara, Jaime Cubero, Joël F. Pothier, Eran Bosis, Claude Bragard, Edyta Đermić, Maria C. Holeva, Marie-Agnès Jacques, Francoise Petter, Olivier Pruvost, Isabelle Robène, David J. Studholme, Fernando Tavares, Joana G. Vicente, Ralf Koebnik, Joana
Microorganisms.2021; 9(4): 862. CrossRef - Species of the genus Xanthomonas infecting cereals and oilseeds in the Russian Federation and its diagnostics
Elena Kyrova, Maria Egorova, Alexander Ignatov, Y. Tokarev, V. Glupov
BIO Web of Conferences.2020; 18: 00017. CrossRef - Loop-Mediated Isothermal Amplification for the Detection of Xanthomonas arboricola pv. pruni in Peaches
Weilan Li, Seung-Yeol Lee, Chang-Gi Back, Leonid N. Ten, Hee-Young Jung
The Plant Pathology Journal.2019; 35(6): 635. CrossRef - Lateral flow immunoassay for on-site detection of Xanthomonas arboricola pv. pruni in symptomatic field samples
Pablo López-Soriano, Patricia Noguera, María Teresa Gorris, Rosa Puchades, Ángel Maquieira, Ester Marco-Noales, María M. López, Ulrich Melcher
PLOS ONE.2017; 12(4): e0176201. CrossRef - Pan-Genomic Analysis Permits Differentiation of Virulent and Non-virulent Strains of Xanthomonas arboricola That Cohabit Prunus spp. and Elucidate Bacterial Virulence Factors
Jerson Garita-Cambronero, Ana Palacio-Bielsa, María M. López, Jaime Cubero
Frontiers in Microbiology.2017;[Epub] CrossRef - Development of a nanostructured immunosensor for early and in situ detection of Xanthomonas arboricola in agricultural food production
Matías Regiart, Martin Rinaldi-Tosi, Pedro R. Aranda, Franco A. Bertolino, Jhonny Villarroel-Rocha, Karim Sapag, Germán A. Messina, Julio Raba, Martín A. Fernández-Baldo
Talanta.2017; 175: 535. CrossRef - Detection and identification of Xanthomonas arboricola pv. pruni from symptomless plant material: results of an Italian test performance study
S. Loreti, N. Pucci, G. Perez, V. Catara, M. Scortichini, P. Bella, P. Ferrante, D. Giovanardi, E. Stefani
EPPO Bulletin.2015; 45(1): 41. CrossRef - The Best Spray Timing for the Control of the Bacterial Shot Hole with Bordeaux mixture (6-6) after Wintering in the Peach Orchard
San Yeong Kim, Won Heum Park, Hee Jung Son, Suk Hee Lee, Young Woon Song, So Deuk Park
The Korean Journal of Pesticide Science.2015; 19(2): 106. CrossRef - A duplex-PCR method for species- and pathovar-level identification and detection of the quarantine plant pathogen Xanthomonas arboricola pv. pruni
J.F. Pothier, M.C. Pagani, C. Pelludat, D.F. Ritchie, B. Duffy
Journal of Microbiological Methods.2011; 86(1): 16. CrossRef
- Development of a Latex Agglutination Test for Norovirus Detection
-
Heetae Lee , YoungBin Park , Misoon Kim , Youngmee Jee , Doo-sung Cheon , Hae Sook Jeong , GwangPyo Ko
-
J. Microbiol. 2010;48(4):419-425. Published online August 20, 2010
-
DOI: https://doi.org/10.1007/s12275-010-0071-4
-
-
50
View
-
0
Download
-
9
Scopus
-
Abstract
-
Norovirus (NoV) is the leading cause of acute gastroenteritis worldwide. Currently, reverse transcription polymerase chain reaction (RT-PCR) is used commonly to detect NoVs in both clinical and environmental samples. However, RT-PCR requires expensive equipment and cannot be performed on site. In this study, a latex agglutination test (LAT) using antibody-labeled latex beads for detecting NoVs was developed. Two kinds of polyclonal antibodies, one generated from synthetic peptides and the other from E. coli-expressed NoV capsid proteins, were used to develop the LAT. Each of these polyclonal antibodies was immobilized on the surface of latex beads and tested for the ability to detect NoVs. Under optimized conditions, our LAT detected GII.4 NoV at concentrations as low as 3.3×105 RT-PCR units/ml in stool samples. The detection limit for the LAT was approximately 1.7×103 RT-PCR units. Forty-eight stool samples were tested for NoVs using this LAT. In comparison with an RT-PCR assay, the sensitivity and specificity of the LAT were 35% and 100%, respectively. With further optimization, this LAT used with appropriate antibodies could be applied for convenient detection of NoVs in clinical diagnosis and food monitoring.
Validation Study
- Rapid Detection of Noroviruses in Fecal Samples and Shellfish by Nucleic Acid Sequence-based Amplification
-
Xiaoxia Kou , Qingping Wu , Jumei Zhang , Hongying Fan
-
J. Microbiol. 2006;44(4):403-408.
-
DOI: https://doi.org/2413 [pii]
-
-
Abstract
-
The purpose of this study was to determine the efficacy of a nucleic acid sequence-based amplification (NASBA) method of detecting noroviruses in artificially and naturally contaminated shellfish. We used 58 fecal samples that tested positive for noroviruses with electron microscopy (EM) to develop an NASBA assay for these viruses. Oligonucleotide primers targeting the polymerase coding region were used to amplify the viral RNA in an isothermal process that resulted in the accumulation of RNA amplicons. These amplicons were detected by hybridization with digoxigenin-labeled oligonucleotide probes that were highly specific for genogroup I (GI) and genogroup II (GII) of noroviruses. The expected band of 327 bp appeared in denaturing agarose gel without any nonspecific band. The specific signal for each amplicon was obtained through Northern blotting in many repeats. All fecal samples of which 46 (79.3%) belonged to GII and 12 (20.6%) belonged to GI were positive for noroviruses by EM and by NASBA. Target RNA concentrations as low as 5 pg/ml were detected in fecal specimens using NASBA. When the assay was applied to
artificially contaminated shellfish, the sensitivity to nucleic acid was 100 pg/1.5 g shellfish tissue. The potential use of this assay was also confirmed in naturally contaminated shellfish collected from different ponds in Guangzhou city of China, of which 24 (18.76%) out of 128 samples were positive for noroviruses; of these, 19 (79.6%) belonged to GII and 5 (20.4%) belonged to GI. The NASBA assay provided a more rapid and efficient way of detecting noroviruses in fecal samples and demonstrated its potential for detecting noroviruses in food and environmental samples with high specificity and sensitivity.
Journal Article
- Detection of Hepatitis B Virus and Mycobacterium tuberculosis in Korean Dental Patients
-
Sun-A Lee , So Young Yoo , Kee-Sung Kay , Joong-Ki Kook
-
J. Microbiol. 2004;42(3):239-242.
-
DOI: https://doi.org/2082 [pii]
-
-
Abstract
-
This study examined the detection rate of the hepatitis B virus (HBV) and Mycobacterium tuberculosis (Mtb) in serum and saliva samples, respectively, from 120 dental patients who were unaware if they have or had either hepatitis or tuberculosis. The frequencies of HBsAg and anti-HBs were determined using an immunochromatic assay. Mtb positivity was determined by the PCR method. Of the 120 patients, 7 (5.8%) were HBV positive and 30 (25.0%) were Mtb positive. This highlights the fact that dental health care workers (DHCWs) can be exposed to the risk of infection from blood- or saliva-borne pathogens as a consequence of their work. Therefore, it is very important to prevent cross infection between patients and dental personnel. Accordingly, laboratory tests prior to surgical treatment are needed to determine the infectious state of dental patients in order to prevent the transmission of infectious diseases in dental clinics.
- Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae
-
Hee Jong Kim , Youn Su Lee
-
J. Microbiol. 2001;39(1):56-61.
-
-
-
Abstract
-
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set from the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCTTTGA (PB-2). This primer set was used to specifically detect P. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia spp., as well as bacteria such as Pseudomonas spp. and Erwinia spp. did not show any reaction with the primer set.