Skip Navigation
Skip to contents

Journal of Microbiology : Journal of Microbiology

OPEN ACCESS
SEARCH
Search

Articles

Page Path
HOME > J. Microbiol > Volume 63(5); 2025 > Article
Full article
Role of the LAMMER kinase LkhA in fungal development and aflatoxin production in Aspergillus flavus
Seong-Hwan Jeong1, He-Jin Cho2, Jae-Hyuk Yu3, Hee-Moon Park4, Hee-Soo Park1,2,3,5,*
Journal of Microbiology 2025;63(5):e2503007.
DOI: https://doi.org/10.71150/jm.2503007
Published online: May 27, 2025

1Department of Integrative Biology, Kyungpook National University, Daegu 41566, Republic of Korea

2School of Food Science and Biotechnology, Kyungpook National University, Daegu 41566, Republic of Korea

3Department of Bacteriology, University of Wisconsin-Madison, Madison, Wisconsin 53706, USA

4Department of Microbiology and Molecular Biology, College of Bioscience and Biotechnology, Chungnam National University, Daejeon 34134, Republic of Korea

5Department of Advanced Bioconvergence, Kyungpook National University, Daegu 41566, Republic of Korea

*Correspondence Hee-Soo Park phsoo97@knu.ac.kr
• Received: March 11, 2025   • Revised: March 28, 2025   • Accepted: April 1, 2025

© The Microbiological Society of Korea

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 1,358 Views
  • 50 Download
  • A well-conserved LAMMER kinase in yeast and filamentous fungi, is a dual-specificity kinase with multiple roles in fungal biology. In this study, we assessed the roles of LkhA in Aspergillus flavus, a toxigenic fungus that produces aflatoxin B1. lkhA deletion mutants exhibited defects in fungal growth, conidiophore development, and sclerotia formation. These mutants exhibited impaired tolerance to oxidative and cell wall stresses. Moreover, the absence of lkhA resulted in a decrease in aflatoxin B1 production. The kernel assay revealed that the lkhA deletion mutants exhibited reduced production of conidia and aflatoxin B1, implying that LkhA can affect fungal toxigenesis and pathogenicity. Taken together, these results demonstrate that LkhA is important for differentiation, mycotoxin production, and pathogenicity in A. flavus.
Aspergillus flavus is a pathogenic fungus that infects peanuts and corn and causes economic losses (Amaike and Keller, 2011; Fountain et al., 2014; Hedayati et al., 2007). This fungus produces aflatoxin B1, a class 1 carcinogen, in crops (Klich, 2007; Kumar et al., 2021). Contamination by aflatoxins produced by A. flavus has been reported to result in harvest losses worth millions of dollars from crops like corn and peanuts (Amaike and Keller, 2011). Moreover, A. flavus is an opportunistic fungus in animals and the second most common cause of aspergillosis in immunocompromised humans (Krishnan et al., 2009; Lim and Park, 2019; Pasqualotto, 2009).
A. flavus is known to reproduce asexually or sexually; it primarily reproduces asexually (Horn et al., 2009; Krijgsheld et al., 2013; Ojeda-López et al., 2018). The asexual reproduction of A. flavus results in the production of asexual spores called conidia, which are elaborately regulated by BrlA–AbaA–WetA, transcription factors involved in a central regulatory cascade (Cho et al., 2022; Park and Yu, 2012a). The formed conidia spread in the air and regulate the onset of germination depending on the environment (Baltussen et al., 2020; Wang et al., 2021). The asexual reproductive cycle of A. flavus begins with the germination of conidia, followed by the formation of new conidia (Baltussen et al., 2020; Park and Yu, 2012a). Sexual reproduction results in the formation of sexual structures called sclerotia under certain conditions (Dyer and O'Gorman, 2012; Horn et al., 2016). Sclerotia contain sexual spores and help protect them from extreme environments (Dyer and O'Gorman, 2012). Asexual or sexual spores remain dormant when A. flavus is in an environment unfavorable for its survival; they germinate again when the environment improves (Coley-Smith and Cooke, 1971; Wicklow, 1987). Both asexual and sexual forms of development are induced by specific conditions and regulated by various signaling mechanisms (Park et al., 2019; Park and Yu, 2016). Stress resistance and secondary metabolism are the results of adaptation to various environments and are associated with kinase-related signaling pathways (Lin et al., 2021; Zhao et al., 2007).
The dual-specificity LAMMER kinases are evolutionarily conserved across diverse species ranging from yeast to mammals and have multiple functions in various physiological processes (Kang et al., 2013; Lim et al., 2021; Lim and Park, 2019). The LAMMER kinase family is essential for the phosphorylation of serine/threonine and tyrosine residues (Lim and Park, 2019; Yun et al., 1994). The name “LAMMER kinase” is derived from the “EHLAMMERILG” motif in subdomain X (Duan et al., 2016; Yun et al., 1994). The LAMMER kinase motif is important for substrate recognition, activity, and localization (Kang et al., 2010; Savaldi-Goldstein et al., 2003). LAMMER kinases play essential roles in mammals, with deficiency mutations causing various diseases, such as cancer (Chowdhury et al., 2023). In fungi, LAMMER kinases are involved in various biological processes (Lim and Park, 2019). LkhA plays a role in hyphal growth, sexual reproduction, and asexual reproduction in A. nidulans (Kang et al., 2013). In A. fumigatus, LkhA is involved in sexual and asexual reproduction, causing changes in gliotoxin production and cell wall composition. It also affects the pathogenicity of A. fumigatus (Lim et al., 2021; Lim and Park, 2019). However, the role of LAMMER kinases has not yet been studied in A. flavus.
Therefore, in this study, we assessed the role of the LAMMER kinase LkhA in the toxin-producing fungus A. flavus. Based on the results obtained in other fungal species, such as A. fumigatus and A. nidulans, we hypothesized that this LAMMER kinase plays a role in cell growth and toxin production in A. flavus. To test this hypothesis, we generated the lkhA deletion mutant (ΔlkhA strain) and assessed its phenotype.
Phylogenetic analysis
The LAMMER kinase protein sequences of A. nidulans FGSC A4, A. fumigatus Af293, and Aspergillus section Flavi were downloaded from FungiDB (https://fungidb.org/). A phylogenetic tree of LAMMER kinase orthologs was generated using MEGA7 software with the maximum likelihood method based on the Jones-Taylor-Thornton (JTT) matrix-based model (http://www.megasoftware.net/). A bootstrap consensus tree was inferred from 1,000 replicates, and the taxa in this tree were assumed to represent evolutionary history. The domain was analyzed using NCBI’s Conserved Domain Database (CDD) under the ID cd14134.
Strains, media, and culture conditions
The fungal strains used in this study are listed in Table 1. A. flavus strains were cultured at 30°C or 37°C in glucose minimal medium containing 0.1% yeast extract (MMYE) with the appropriate supplements (Barratt et al., 1965). A. flavus NRRL 3357.5, a pyrG auxotrophic mutant strain, was grown on MMYE supplemented with uridine and uracil (He et al., 2007). For transformation, Escherichia coli DH5α cells were grown in Luria-Bertani (LB) broth with or without ampicillin.
Construction of deletion mutant and complemented strains
The primers used to construct deletion mutant and complemented strains are listed in Table 2. Gene deletion cassettes were generated using double-joint PCR (DJ-PCR) (Yu et al., 2004). Initially, the 5′ and 3′ flanking regions were amplified from A. flavus NRRL 3357 genomic DNA (gDNA) using the primer sets OHS2349:OHS2350 and OHS2351:OHS2352, respectively. The A. fumigatus pyrG+ marker was amplified from A. fumigatus AF293 using OHS1542:OHS1543. The products and the marker were re-amplified using OHS2353:OSH2354 to generate the lkhA deletion cassette. This cassette was transformed into the protoplast of A. flavus NRRL 3357.5. Protoplasts were generated using VinoTaste® Pro (Novozymes, Denmark) (Lee et al., 2016). Transformation candidates were confirmed by performing PCR, restriction enzyme treatment, and quantitative reverse-transcription PCR (qRT-PCR). Three independent ΔlkhA strains (TJSH4.1–3) were isolated.
To generate the complemented strain, the promoter and ORF of lkhA were amplified using OHS2565:OHS2405. The PCR product was digested with NotⅠ, and the digested product was then cloned into pYES1, including the 4× FLAG tag, ptrA, and the amyB terminator. The resulting plasmid, pJSH1, was transformed into TJSH4.1. Final complemented strains (TJSH5.1 and 2) were verified by performing PCR and qRT-PCR.
qRT-PCR
RNA samples were obtained using a previously described protocol (Park et al., 2012; Park and Yu, 2012b). In brief, conidia of control and mutant stains were inoculated in liquid MMYE media and cultured at 37°C with shaking at 200 rpm for 16 h. The grown mycelia were filtered through Miracloth (Calbiochem, USA), washed with desterilized water, and spread in a monolayer on solid MMYE to induce asexual development. Samples for RNA extraction were obtained at each designated time (Eom et al., 2018). The samples were mixed with TRIzol reagent (Invitrogen, USA), homogenized using a mini-bead beater, and centrifuged to obtain the supernatant. The supernatant was transferred into a new vial in the presence of cold isopropanol. DNase I (Promega, USA) was added to each sample to remove DNA contamination. The purity and concentration of RNA were measured using an ultraviolet (UV) spectrophotometer. Complementary DNA (cDNA) was synthesized using GoScript reverse transcriptase (Promega, USA). qPCR was performed using the iTaq Universal SYBR Green Supermix (Bio-Rad, USA) and the CFX96 Touch Real-Time PCR System (Bio-Rad). The β-actin gene was used as a control. All experiments were performed in triplicate. The primers used for qPCR are listed in Table 2.
Physiological analyses
To analyze asexual development, control, deletion mutant, and complemented strains were inoculated onto solid MMYE media and incubated for 5 days at 37°C in light. The diameter of the colony of each strain was then measured to assess fungal growth. To measure the number of conidia, conidia were collected from 5-day-old culture plates and counted using a hemocytometer.
To assess the formation of sclerotia, control or mutant strains were inoculated onto solid MMYE agar and incubated at 37°C for 7 days in darkness. To assess the formation of sclerotia, the cultured plates were washed with 70% ethanol and the number of sclerotia was then counted. All experiments were performed in triplicate.
Photographs of each strain were taken using a Pentax MX-1 digital camera, and micrographs were taken using a Zeiss Lab.A1 microscope equipped with AxioCam 105 and AxioVision (Rel. 4.9) digital imaging software.
Stress sensitivity test
To determine whether stress affects fungal growth, control, deletion mutant, and complemented strains were inoculated onto solid MMYE medium containing Congo red (cell wall stressor) or hydrogen peroxide (H2O2) (oxidative stressor) and incubated at 37°C for 3 days. The inhibition rate was determined by calculating the area based on the diameter. The experiment was performed in triplicate for each strain.
Aflatoxin B1 extraction and thin-layer chromatography (TLC)
To extract aflatoxin B1 each strain was inoculated into complete medium (CM) and incubated at 30°C for 7 days (Eom et al., 2018). Subsequently, CHCl3 was added to extract aflatoxin B1 from the grown cultures. Each sample was mixed using Voltexer, and the organic phase was separated by centrifugation. The organic phase was then filtered through Whatman filter paper and treated with Na2SO4. The samples and aflatoxin B1 as standard were spotted onto TLC silica plates (Kieselgel 60, 0.25 mm, Merck KGaA, Germany). A chloroform:acetone solution (8:2 ratio) was used for saturation in the chamber to separate the mixture. To detect aflatoxin B1, the plate containing the samples was examined under 366 nm UV light irradiation. Aflatoxin B1 band intensity was quantified using ImageJ software. The experiment was performed in triplicate for each strain.
Kernel bioassay
Corn kernels (Cheongnong, Korea) were treated with 70% ethanol, washed with ddH2O, and treated with bleach thrice. Then, the kernels were placed on a plate, inoculated with each strain, and incubated at 30°C for 7 days. Conidia from each kernel were obtained using 2 ml of 0.01% Tween 20, and the number of conidia was counted using a hemocytometer. To extract aflatoxin B1, kernels were mixed with CHCl3 for 4 h. The conidia were then crushed with a bead beater (BioSpec Products Inc., USA), and the aflatoxin B1 was extracted using a previously described method (Christensen et al., 2012).
Statistical analysis
Statistical analysis was performed using GraphPad Prism (version 5.01). Statistical differences between strains were assessed using Student’s unpaired t-test, with error bars representing standard errors of the means of triplicate measurements. Moreover, p values < 0.05 were considered to indicate significant differences between control and deletion mutant strains (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001).
Domain analysis of LkhA in A. flavus
Recent studies have analyzed the domains of LkhA in two Aspergillus species: A. nidulans and A. fumigatus. XP_041140912.1, a LAMMER kinase from A. flavus, was identified using “EHLAMMERILG,” a conserved motif of known LAMMER kinases from A. nidulans and A. fumigatus (Kang et al., 2013; Lim et al., 2021; Lim and Park, 2019). Based on XP_041140912.1, homology was confirmed with Aspergillus section Flavi, A. nidulans, and A. fumigatus. In the NCBI database, LkhA could only be identified in 19 species of Aspergillus section Flavi. Therefore, we analyzed the phylogenetic tree and domain of LkhA in A. nidulans, A. fumigatus, and 19 species of Aspergillus section Flavi. Our results suggest that XP_041140912.1 encodes the LkhA homolog in A. flavus (Fig. 1).
Role of LkhA in asexual development
As LkhA plays a role in asexual reproduction in A. nidulans (Kang et al., 2013), we hypothesized that LkhA is also involved in asexual reproduction in A. flavus. To test this hypothesis, we generated a ΔlkhA strain and a lkhA complemented strain (C' lkhA strain) and performed phenotypic analysis (Fig. 2). We found that the colony diameter and number of conidia in the ΔlkhA strain were lower than those in the control strain in the presence of light (Fig. 2B). Microscopic analysis revealed that the ΔlkhA strain formed abnormal conidiophores (Fig. 2C). The mRNA expression of brlA in the ΔlkhA strain decreased 12 h after the induction of conidiation. Moreover, the mRNA expression of abaA in the ΔlkhA strain was lower than that in the control or C' lkhA strain at 12 and 24 h after the induction of asexual development (Fig. 2D). These results suggest that LkhA is essential for proper asexual development in A. flavus.
Role of LkhA in sexual development
LkhA plays a role in sexual development in A. nidulans and A. fumigatus (Kang et al., 2013; Lim et al., 2021). Therefore, we assessed the role of LkhA in sexual reproduction in A. flavus. We inoculated each strain onto solid MMYE medium and incubated it for 7 days in darkness. We then washed the culture with alcohol and counted the number of sclerotia (Fig. 3A). We did not detect normal sclerotia in the ΔlkhA strain (Fig. 3A). The number of sclerotia in the ΔlkhA strain was dramatically lower than that in the control or C' lkhA strain (Fig. 3B), suggesting that LkhA plays an essential role in sexual development in A. flavus.
Role of LkhA in stress response
Studies have revealed that the LAMMER kinases Kns1 in S. cerevisiae and Lkh1 in Schizosaccharomyces pombe are important for various stress responses (Kang et al., 2007; Park et al., 2003; Park and Park, 2011). To assess the role of LkhA in A. flavus, we inoculated control and ΔlkhA strains onto media containing H2O2 or Congo red. As shown in Fig. 4, the growth of the ΔlkhA strain was significantly reduced under oxidative or cell wall stress conditions. Under osmotic stress conditions, no significant change was noted in the growth of the ΔlkhA strain compared with that of the control or C' lkhA strain (data not shown). These results suggest that LkhA is required for fungal response to a cell wall-perturbing agent or an oxidative stressor.
Role of LkhA in aflatoxin B1 production
To assess the role of LkhA in aflatoxin B1 production, we cultured control, ΔlkhA, and C' lkhA strains in CM for 10 days. Subsequently, we extracted aflatoxin B1 from each cultured sample and quantified its amount using TLC. As shown in Fig. 5, the production of aflatoxin B1 was significantly lower in the ΔlkhA strain than in the control strain. This suggests that LkhA plays an important role in aflatoxin B1 production in A. flavus.
Role of LkhA in pathogenicity
To determine whether LkhA from A. flavus is involved in pathogenicity, we inoculated control, ΔlkhA, and C' lkhA strains onto corn. We then assessed conidial formation and aflatoxin B1 production (Fig. 6A). The ΔlkhA strain exhibited lower conidial formation than the control strain (Fig. 6B). Moreover, the ΔlkhA strain exhibited lower aflatoxin B1 production than the control and C' lkhA strains (Fig. 6C and 6D). These results suggest that LkhA is required for proper plant pathogenicity.
LAMMER kinases are conserved in most eukaryotes and are essential for appropriate regulation of growth, development, and stress responses (Lim and Park, 2019). Studies have revealed that LAMMER kinases play a key role in fungal development (Lim and Park, 2019). In A. nidulans, the ΔlkhA strain was found to form smaller colonies and produce fewer asexual spores than the wild type. The ΔlkhA strain also had an abnormal structure (Kang et al., 2013). Moreover, the ΔlkhA strain exhibited reduced colony growth and reduced number of conidia (Lim et al., 2021). In the present study, the deletion of lkhA affected fungal growth, conidial production, and conidiophore structure (Fig. 2). These results suggest that LkhA is a key component for regulating fungal growth and asexual development. Further analyses revealed that the absence of lkhA lowered the mRNA expression of brlA, a key initiator of conidiation, in the three Aspergillus strains. The mRNA expression of abaA also decreased in A. nidulans and A. flavus. Taken together, we propose that LkhA regulates conidiogenesis through the regulation of BrlA–AbaA–WetA.
We also found that the production of sexual reproductive structures known as sclerotia was significantly reduced or absent in the ΔlkhA strain (Fig. 3). In A. nidulans, the ΔlkhA strain was found to produce immature cleistothecia containing few ascospores (Kang et al., 2013). A similar phenotype was confirmed in A. fumigatus, which produced cleistothecia but with a significantly smaller amount of ascospores (Lim et al., 2021). In A. nidulans and A. fumigatus, LkhA was confirmed to play an important role in the maturation of cleistothecia; however, in A. flavus, it was hardly able to form sclerotia. Hence, LkhA can be predicted to be involved from the early stage of sexual development.
Fungal LAMMER kinases are required for stress tolerance (Lim and Park, 2019). However, LAMMER kinases respond differently to various stresses depending on the fungal species. For example, in S. pombe, Lkh1 is required for oxidative stress tolerance. However, in A. fumigatus, LkhA is not involved in oxidative stress tolerance (Kang et al., 2007; Lim et al., 2021). In A. nidulans and Candida albicans, LkhA and Kns1, respectively, are required for proper cell wall biosynthesis (Lim and Park, 2019). In this study, we found that fungal growth was defective under oxidative and cell wall stress conditions (Fig. 4). However, no growth defects were noted under osmotic stress conditions (data not shown). Overall, these findings suggest that the LAMMER kinases play a vital role in stress response; however, their role varies among fungal species.
A. flavus not only produces mycotoxins but also acts as a plant and human pathogen (Klich, 2007). The production of aflatoxins by A. flavus is influenced by environmental conditions, with oxidative stress being particularly linked to aflatoxin biosynthesis (Sweany et al., 2022). The ΔlkhA strain exhibited significantly reduced aflatoxin production in CM (Fig. 5); however, aflatoxin production was only partially reduced in the kernel model (Fig. 6). Hence, these changes in aflatoxin B1 production may be attributed to differences in culture conditions. Aflatoxin B1 produced by A. flavus is classified as a group 1 carcinogen that can cause hepatocellular carcinoma (Rushing and Selim, 2019). Aflatoxins produced by A. flavus in various crops, such as corn and maize, cause economic losses; however, their specific impact on plant pathogenicity has not been studied so far (Sweany et al., 2022). We noted a decrease in aflatoxin B1 production due to the deletion of lkhA in CM and the kernel model. These results support that LkhA can affect human pathogenicity; however, further research is warranted to determine its role in plant pathogenicity.
The role of LAMMER kinases has been studied in several fungi (Lim and Park, 2019). In the plant pathogenic fungus Magnaporthe oryzae (Li et al., 2022), the Δkns1 mutant strain exhibited reduced asexual spore production. Moreover, no spores were formed on barley leaves, indicating a decrease in pathogenicity (Li et al., 2022). In A. flavus, the ΔlkhA strain exhibited reduced production of conidia in the kernel assay (Fig. 6), confirming that LkhA plays a role in plant pathogenicity. Studies have also been conducted on human pathogenic fungi, including C. albicans, A. fumigatus, and Cryptococcus neoformans. In C. albicans, the deletion of KNS1 affected adhesion ability in a zebrafish embryo model; however, it did not influence embryo hatching (Lim et al., 2020). In A. fumigatus, the ΔlkhA mutant strain exhibited a decreased mortality rate in zebrafish larvae (Lim et al., 2021). In C. neoformans, the ΔlkhA mutant strain was avirulent in a systemic murine model (Kwon et al., 2024). Although the role of LkhA in human or animal pathogenicity has not been studied in A. flavus, the decrease in aflatoxin B1, a key virulence factor, suggests that LkhA influences human pathogenicity. Further research is warranted to confirm its pathogenicity in humans or animals.
Overall, our study confirmed that LkhA plays an important role in development, stress tolerance, aflatoxin production, and pathogenicity in A. flavus. To our knowledge, this is the first study to confirm the roles of LkhA in A. flavus. Our results will provide insights into the development of antifungal agents for A. flavus, which infects crops, causes economic losses, and harms humans.
Fig. 1.
Domain analysis of LkhA. A phylogenetic tree of LkhA homologs of 19 Aspergillus section Flavi species, including XP_023089190.1 (A. oryzae RIB40), XP_031930370.1 (A. caelatus), KJK63013.1 (A. parasiticus SU-1), KAB8199148.1 (A. parasiticus), KAE8330775.1 (A. sergii), PIG84118.1 (A. arachidicola), XP_041140912.1 (A. flavus NRRL 3357), KAE8164884.1 (A. tamarii), KAE8419194.1 (A. pseudocaelatus), XP_031899499.1 (A. alliaceus), KAE8355958.1 (A. coremiiformis), KAB8272224.1 (A. minisclerotigenes), XP_031918567.1 (A. pseudotamarii), XP_031939356.1 (A. pseudonomiae), KAE8373119.1 (A. bertholletiae), KAB8074254.1 (A. leporis), KAF7586444.1 (A. hacockii), KAE8147474.1 (A. avenaceus), XP.753046.1 (A. fumigatus Af293), XP_0540469095.1 (A. nidulans FGSC A4), and XP_015400930.1 (A. nomiae NRRL 13137). Conservation of the LAMMER motif was analyzed using MEGA7 and the NCBI database.
jm-2503007f1.jpg
Fig. 2.
Roles of LkhA in fungal growth and asexual development. (A) Photographs and micrographs of control, lkhA deletion mutant, and lkhA complemented strains cultured for 5 days in light. (B) Diameter and number of conidia measured in the presence of light. (C) Appearance of conidiophores grown in light 2 days after inoculation. (D) The mRNA expression levels of brlA and abaA, which are key regulatory genes for asexual development, were analyzed in control, lkhA deletion mutant, and lkhA complemented strains by performing qRT-PCR. RNA samples from each strain were used at 0, 12, and 24 h after the induction of asexual development. Error bars represent the standard errors of the means from triplicate measurements (Control versus ΔlkhA strain, **p ≤ 0.01, ***p ≤ 0.001).
jm-2503007f2.jpg
Fig. 3.
Roles of LkhA in sexual development. (A) Photographs of control, lkhA deletion mutant, and lkhA complemented strains cultured for 7 days in darkness. Bottom: Photographs of control, lkhA deletion mutant, and lkhA complemented strains after ethanol washing. (B) Quantitative data of sclerotia, indicative of sexual reproduction (***p ≤ 0.001).
jm-2503007f3.jpg
Fig. 4.
Characterization of roles of LkhA in stress response. (A) Photographs of control, lkhA deletion mutant, and lkhA complemented strains grown at 37°C for 3 days in MMYE medium supplemented with hydrogen peroxide (oxidative stressor) or Congo red (cell wall stressor). (B) Quantitative data of inhibition ratio, and formula for calculating inhibition ratio (***p ≤ 0.001).
jm-2503007f4.jpg
Fig. 5.
Roles of LkhA in aflatoxin B1 production. (A) Photograph of aflatoxin B1 isolated by thin-layer chromatography from control, lkhA deletion mutant, and lkhA complemented strains. Aflatoxin B1 was extracted from strains grown for 7 days in CM. Aflatoxin B1 was used as a standard substance. (B) Band intensity of aflatoxin B1 assessed using ImageJ software (***p ≤ 0.001).
jm-2503007f5.jpg
Fig. 6.
Roles of LkhA in plant pathogenicity. (A) Photograph of corn kernels inoculated with control, lkhA deletion mutant, and lkhA complemented strains. (B) Quantitative data of the number of conidia in A. flavus inoculated on corn. (C) Photograph of aflatoxin B1 isolated from each strain by TLC. (D) Band intensity of aflatoxin B1 separated by TLC using ImageJ software (***p ≤ 0.001).
jm-2503007f6.jpg
Table 1.
Aspergillus flavus strains used in this study
Strain Relevant genotype Reference
NRRL 3357 A. flavus wild type ATCC collection
NRRL 3357.5 pyrG He et al. (2007)
TTJ6.1 pyrG; ΔpyrG::AfupyrG+ Lim et al. (2019)
TJSH4.1–3 pyrG; ΔlkhA::AfupyrG+ This study
TJSH5.1 and 2 pyrG; lkhA(p)::lkhA::FLAG4x::ptrA; ΔlkhA::AfupyrG+ This study
Table 2.
Primers used in this study
Name Sequence (5′→3′)a Purpose
OHS1542 CCTGGTCTTTGGTTTGGTACACC AfupyrG Maker_F
OHS1543 CGACTGGCAGGAGATGATCC AfupyrG Maker_R
OHS2349 CTACACTTCGATGAGCCTTGC 5′ AfllkhA DF
OHS2350 GGCTTTGGCCTGTATCATGACTTCA GCAGTGACCGTCGTACTCTAC 3′ AfllkhA with AfupyrG tail
OHS2351 TTTGGTGACGACAATACCTCCCGAC GTCGTGTTGATCTCAAGTGGC 5′ AfllkhA with AfupyrG tail
OHS2352 CAGTGAGAACTCGTGCAGG 3′ AfllkhA DR
OHS2353 CTCTCGGTATTACTGACTACGACG 5′ AfllkhA NF
OHS2354 GTTCTGCACGACAGTGCAT 3′ AfllkhA NR
OHS2355 CATCATCAGCAGCACTACGG 5′ AfllkhA RT_F
OHS2356 CGTAGGGATATGTGGTGGCA 3′ AfllkhA RT_R
OHS2565 aatt GCGGCCGC CCTACCTCAGATCGACATTGCA 5′ AfllkhA NotI_F
OHS2405 aatt GCGGCCGC GGTGTTGCGCTGCAACTG 3′ AfllkhA NotI_R
OHS407 GATATGTCGCCACACTGGAC AflbrlA RT_F
OHS408 CTGTATTCGCGGCTATTCGG AflbrlA RT_R
OHS409 CTTCCGCACCTTAACAGCAG AflabaA RT_F
OHS410 GTTTGCCGGAATTGCCAAAG AflabaA RT_R
OHS405 TATGTCGGTGATGAGGCACA Aflactin RT_F
OHS406 AACACGGAGCTCGTTGTAGA Aflactin RT_R

aTail sequences are shown in italics. Restriction enzyme sites are presented in bold.

  • Amaike S, Keller NP. 2011. Aspergillus flavus. Annu Rev Phytopathol. 49: 107–133. ArticlePubMed
  • Baltussen TJ, Zoll J, Verweij PE, Melchers WJ. 2020. Molecular mechanisms of conidial germination in Aspergillus spp. Microbiol Mol Biol Rev. 84: e00049–19. ArticlePubMedLink
  • Barratt RW, Johnson GB, Ogata WN. 1965. Wild-type and mutant stocks of Aspergillus nidulans. Genetics. 52: 233–246. ArticlePubMedPMCPDF
  • Cho HJ, Son SH, Chen W, Son YE, Lee I, et al. 2022. Regulation of conidiogenesis in Aspergillus flavus. Cells. 11: 2796.ArticlePubMedPMC
  • Chowdhury I, Dashi G, Keskitalo S. 2023. Cmgc kinases in health and cancer. Cancers. 15: 3838.ArticlePubMedPMC
  • Christensen S, Borrego E, Shim WB, Isakeit T, Kolomiets M. 2012. Quantification of fungal colonization, sporogenesis, and production of mycotoxins using kernel bioassays. J Vis Exp. 62: e3727. Article
  • Coley-Smith J, Cooke R. 1971. Survival and germination of fungal sclerotia. Annu Rev Phytopathol. 9: 65–92. Article
  • Duan L, Xiao W, Xia F, Liu H, Xiao J, et al. 2016. Two different transcripts of a LAMMER kinase gene play opposite roles in disease resistance. Plant Physiol. 172: 1959–1972. ArticlePubMedPMC
  • Dyer PS, O'Gorman CM. 2012. Sexual development and cryptic sexuality in fungi: Insights from Aspergillus species. FEMS Microbiol Rev. 36: 165–192. ArticlePubMed
  • Eom TJ, Moon H, Yu JH, Park HS. 2018. Characterization of the velvet regulators in Aspergillus flavus. J Microbiol. 56: 893–901. ArticlePubMedPDF
  • Fountain JC, Scully BT, Ni X, Kemerait RC, Lee RD, et al. 2014. Environmental influences on maize-Aspergillus flavus interactions and aflatoxin production. Front Microbiol. 5: 40.ArticlePubMedPMC
  • He ZM, Price MS, OBrian GR, Georgianna DR, Payne GA. 2007. Improved protocols for functional analysis in the pathogenic fungus Aspergillus flavus. BMC Microbiol. 7: 104.ArticlePubMedPMCPDF
  • Hedayati M, Pasqualotto A, Warn P, Bowyer P, Denning D. 2007. Aspergillus flavus: Human pathogen, allergen and mycotoxin producer. Microbiology. 153: 1677–1692. ArticlePubMed
  • Horn BW, Gell RM, Singh R, Sorensen RB, Carbone I. 2016. Sexual reproduction in Aspergillus flavus sclerotia: Acquisition of novel alleles from soil populations and uniparental mitochondrial inheritance. PLoS One. 11: e0146169. ArticlePubMedPMC
  • Horn BW, Moore GG, Carbone I. 2009. Sexual reproduction in Aspergillus flavus. Mycologia. 101: 423–429. ArticlePubMed
  • Kang EH, Kim Ja, Oh HW, Park HM. 2013. LAMMER kinase LkhA plays multiple roles in the vegetative growth and asexual and sexual development of Aspergillus nidulans. PLoS One. 8: e58762. ArticlePubMedPMC
  • Kang WH, Park YD, Hwang JS, Park HM. 2007. RNA-binding protein Csx1 is phosphorylated by LAMMER kinase, Lkh1, in response to oxidative stress in Schizosaccharomyces pombe. FEBS Lett. 581: 3473–3478. ArticlePubMed
  • Kang WH, Park YH, Park HM. 2010. The LAMMER kinase homolog, Lkh1, regulates tup transcriptional repressors through phosphorylation in Schizosaccharomyces pombe. J Biol Chem. 285: 13797–13806. ArticlePubMedPMC
  • Klich MA. 2007. Aspergillus flavus: The major producer of aflatoxin. Mol Plant Pathol. 8: 713–722. ArticlePubMed
  • Krijgsheld P, Bleichrodt Rv, van Veluw G, Wang F, Müller W, et al. 2013. Development in Aspergillus. Stud Mycol. 74: 1–29. ArticlePubMed
  • Krishnan S, Manavathu EK, Chandrasekar PH. 2009. Aspergillus flavus: An emerging non-fumigatus Aspergillus species of significance. Mycoses. 52: 206–222. ArticlePubMed
  • Kumar A, Pathak H, Bhadauria S, Sudan J. 2021. Aflatoxin contamination in food crops: causes, detection, and management: a review. Food Prod Process Nutr. 3: 17.ArticlePDF
  • Kwon S, Choi Y, Kim ES, Lee KT, Bahn YS, et al. 2024. Pleiotropic roles of LAMMER kinase, Lkh1 in stress responses and virulence of Cryptococcus neoformans. Front Cell Infect Microbiol. 14: 1369301.ArticlePubMedPMC
  • Lee MK, Kwon NJ, Lee IS, Jung S, Kim SC, et al. 2016. Negative regulation and developmental competence in Aspergillus. Sci Rep. 6: 28874.ArticlePubMedPMCPDF
  • Li L, Zhu XM, Wu JQ, Cao N, Bao JD, et al. 2022. The LAMMER kinase MoKns1 regulates growth, conidiation and pathogenicity in Magnaporthe oryzae. Int J Mol Sci. 23: 8104.ArticlePubMedPMC
  • Lim JY, Kim YJ, Woo SA, Jeong JW, Lee YR, et al. 2021. The LAMMER kinase, LkhA, affects Aspergillus fumigatus pathogenicity by modulating reproduction and biosynthesis of cell wall PAMPs. Front Cell Infect Microbiol. 11: 756206.ArticlePubMedPMC
  • Lim JY, Park HM. 2019. The dual-specificity LAMMER kinase affects stress-response and morphological plasticity in fungi. Front Cell Infect Microbiol. 9: 213.ArticlePubMedPMC
  • Lim JY, Park YH, Pyon YH, Yang JM, Yoon JY, et al. 2020. The LAMMER kinase is involved in morphogenesis and response to cell wall- and DNA-damaging stresses in Candida albicans. Med Mycol. 58: 240–247. ArticlePubMedPDF
  • Lim SY, Son YE, Lee DH, Eom TJ, Kim MJ, et al. 2019. Function of crzA in fungal development and aflatoxin production in Aspergillus flavus. Toxins (Basel). 11: 567.ArticlePubMedPMC
  • Lin L, Wu J, Jiang M, Wang Y. 2021. Plant mitogen-activated protein kinase cascades in environmental stresses. Int J Mol Sci. 22: 1543.ArticlePubMedPMC
  • Ojeda-López M, Chen W, Eagle C, Gutiérrez G, Jia W, et al. 2018. Evolution of asexual and sexual reproduction in the aspergilli. Stud Mycol. 91: 37–59. ArticlePubMedPMC
  • Park YD, Kang WH, Yang WS, Shin KS, Bae KS, et al. 2003. LAMMER kinase homolog, Lkh1, is involved in oxidative-stress response of fission yeast. Biochem Biophys Res Commun. 311: 1078–1083. ArticlePubMed
  • Park HS, Lee MK, Han KH, Kim MJ, Yu JH. 2019. Developmental decisions in Aspergillus nidulans. In Hoffmeister D, Gressler M. (eds.), Biology of the fungal cell. pp. 63–80. Springer, Cham.Article
  • Park HS, Ni M, Jeong KC, Kim YH, Yu JH. 2012. The role, interaction and regulation of the Velvet regulator VelB in Aspergillus nidulans. PLoS One. 7: e45935. ArticlePubMedPMC
  • Park YH, Park HM. 2011. Temperature sensitivity of sigma background is suppressed by the disruption of ScKNS1 in Saccharomyces cerevisiae. Korean J Microbiol. 47: 167–169.Link
  • Park HS, Yu JH. 2012a. Genetic control of asexual sporulation in filamentous fungi. Curr Opin Microbiol. 15: 669–677. Article
  • Park HS, Yu JH. 2012b. Multi-copy genetic screen in Aspergillus nidulans. In Keller N, Turner G. (eds.), Fungal secondary metabolism: methods and protocols, vol. 944, pp. 183–190, Humana Press.Article
  • Park HS, Yu JH. 2016. 1 Molecular biology of asexual sporulation in filamentous fungi. In Hoffmeister D. (ed.), The Mycota: Biochemistry and molecular biology, vol. 3, pp. 3–19, Springer, Cham.Article
  • Pasqualotto AC. 2009. Differences in pathogenicity and clinical syndromes due to Aspergillus fumigatus and Aspergillus flavus. Med Mycol. 47: S261–S270. ArticlePubMed
  • Rushing BR, Selim MI. 2019. Aflatoxin B1: A review on metabolism, toxicity, occurrence in food, occupational exposure, and detoxification methods. Food Chem Toxicol. 124: 81–100. ArticlePubMed
  • Savaldi-Goldstein S, Aviv D, Davydov O, Fluhr R. 2003. Alternative splicing modulation by a LAMMER kinase impinges on developmental and transcriptome expression. Plant Cell. 15: 926–938. ArticlePubMedPMC
  • Sweany RR, Breunig M, Opoku J, Clay K, Spatafora JW, et al. 2022. Why do plant-pathogenic fungi produce mycotoxins? Potential roles for mycotoxins in the plant ecosystem. Phytopathology. 112: 2044–2051. ArticlePubMed
  • Wang F, Sethiya P, Hu X, Guo S, Chen Y, et al. 2021. Transcription in fungal conidia before dormancy produces phenotypically variable conidia that maximize survival in different environments. Nat Microbiol. 6: 1066–1081. ArticlePubMedPDF
  • Wicklow D. 1987. Survival of Aspergillus flavus sclerotia in soil. Trans Br Mycol Soc. 83: 131–134. Article
  • Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Domínguez Y, et al. 2004. Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol. 41: 973–981. ArticlePubMed
  • Yun B, Farkas R, Lee K, Rabinow L. 1994. The Doa locus encodes a member of a new protein kinase family and is essential for eye and embryonic development in Drosophila melanogaster. Genes Dev. 8: 1160–1173. ArticlePubMed
  • Zhao X, Mehrabi R, Xu JR. 2007. Mitogen-activated protein kinase pathways and fungal pathogenesis. Eukaryot Cell. 6: 1701–1714. ArticlePubMedPMCLink

Figure & Data

References

    Citations

    Citations to this article as recorded by  

      • ePub LinkePub Link
      • Cite this Article
        Cite this Article
        export Copy Download
        Close
        Download Citation
        Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

        Format:
        • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
        • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
        Include:
        • Citation for the content below
        Role of the LAMMER kinase LkhA in fungal development and aflatoxin production in Aspergillus flavus
        J. Microbiol. 2025;63(5):e2503007  Published online May 27, 2025
        Close
      • XML DownloadXML Download
      Figure
      Role of the LAMMER kinase LkhA in fungal development and aflatoxin production in Aspergillus flavus
      Image Image Image Image Image Image
      Fig. 1. Domain analysis of LkhA. A phylogenetic tree of LkhA homologs of 19 Aspergillus section Flavi species, including XP_023089190.1 (A. oryzae RIB40), XP_031930370.1 (A. caelatus), KJK63013.1 (A. parasiticus SU-1), KAB8199148.1 (A. parasiticus), KAE8330775.1 (A. sergii), PIG84118.1 (A. arachidicola), XP_041140912.1 (A. flavus NRRL 3357), KAE8164884.1 (A. tamarii), KAE8419194.1 (A. pseudocaelatus), XP_031899499.1 (A. alliaceus), KAE8355958.1 (A. coremiiformis), KAB8272224.1 (A. minisclerotigenes), XP_031918567.1 (A. pseudotamarii), XP_031939356.1 (A. pseudonomiae), KAE8373119.1 (A. bertholletiae), KAB8074254.1 (A. leporis), KAF7586444.1 (A. hacockii), KAE8147474.1 (A. avenaceus), XP.753046.1 (A. fumigatus Af293), XP_0540469095.1 (A. nidulans FGSC A4), and XP_015400930.1 (A. nomiae NRRL 13137). Conservation of the LAMMER motif was analyzed using MEGA7 and the NCBI database.
      Fig. 2. Roles of LkhA in fungal growth and asexual development. (A) Photographs and micrographs of control, lkhA deletion mutant, and lkhA complemented strains cultured for 5 days in light. (B) Diameter and number of conidia measured in the presence of light. (C) Appearance of conidiophores grown in light 2 days after inoculation. (D) The mRNA expression levels of brlA and abaA, which are key regulatory genes for asexual development, were analyzed in control, lkhA deletion mutant, and lkhA complemented strains by performing qRT-PCR. RNA samples from each strain were used at 0, 12, and 24 h after the induction of asexual development. Error bars represent the standard errors of the means from triplicate measurements (Control versus ΔlkhA strain, **p ≤ 0.01, ***p ≤ 0.001).
      Fig. 3. Roles of LkhA in sexual development. (A) Photographs of control, lkhA deletion mutant, and lkhA complemented strains cultured for 7 days in darkness. Bottom: Photographs of control, lkhA deletion mutant, and lkhA complemented strains after ethanol washing. (B) Quantitative data of sclerotia, indicative of sexual reproduction (***p ≤ 0.001).
      Fig. 4. Characterization of roles of LkhA in stress response. (A) Photographs of control, lkhA deletion mutant, and lkhA complemented strains grown at 37°C for 3 days in MMYE medium supplemented with hydrogen peroxide (oxidative stressor) or Congo red (cell wall stressor). (B) Quantitative data of inhibition ratio, and formula for calculating inhibition ratio (***p ≤ 0.001).
      Fig. 5. Roles of LkhA in aflatoxin B1 production. (A) Photograph of aflatoxin B1 isolated by thin-layer chromatography from control, lkhA deletion mutant, and lkhA complemented strains. Aflatoxin B1 was extracted from strains grown for 7 days in CM. Aflatoxin B1 was used as a standard substance. (B) Band intensity of aflatoxin B1 assessed using ImageJ software (***p ≤ 0.001).
      Fig. 6. Roles of LkhA in plant pathogenicity. (A) Photograph of corn kernels inoculated with control, lkhA deletion mutant, and lkhA complemented strains. (B) Quantitative data of the number of conidia in A. flavus inoculated on corn. (C) Photograph of aflatoxin B1 isolated from each strain by TLC. (D) Band intensity of aflatoxin B1 separated by TLC using ImageJ software (***p ≤ 0.001).
      Role of the LAMMER kinase LkhA in fungal development and aflatoxin production in Aspergillus flavus
      Strain Relevant genotype Reference
      NRRL 3357 A. flavus wild type ATCC collection
      NRRL 3357.5 pyrG He et al. (2007)
      TTJ6.1 pyrG; ΔpyrG::AfupyrG+ Lim et al. (2019)
      TJSH4.1–3 pyrG; ΔlkhA::AfupyrG+ This study
      TJSH5.1 and 2 pyrG; lkhA(p)::lkhA::FLAG4x::ptrA; ΔlkhA::AfupyrG+ This study
      Name Sequence (5′→3′)a Purpose
      OHS1542 CCTGGTCTTTGGTTTGGTACACC AfupyrG Maker_F
      OHS1543 CGACTGGCAGGAGATGATCC AfupyrG Maker_R
      OHS2349 CTACACTTCGATGAGCCTTGC 5′ AfllkhA DF
      OHS2350 GGCTTTGGCCTGTATCATGACTTCA GCAGTGACCGTCGTACTCTAC 3′ AfllkhA with AfupyrG tail
      OHS2351 TTTGGTGACGACAATACCTCCCGAC GTCGTGTTGATCTCAAGTGGC 5′ AfllkhA with AfupyrG tail
      OHS2352 CAGTGAGAACTCGTGCAGG 3′ AfllkhA DR
      OHS2353 CTCTCGGTATTACTGACTACGACG 5′ AfllkhA NF
      OHS2354 GTTCTGCACGACAGTGCAT 3′ AfllkhA NR
      OHS2355 CATCATCAGCAGCACTACGG 5′ AfllkhA RT_F
      OHS2356 CGTAGGGATATGTGGTGGCA 3′ AfllkhA RT_R
      OHS2565 aatt GCGGCCGC CCTACCTCAGATCGACATTGCA 5′ AfllkhA NotI_F
      OHS2405 aatt GCGGCCGC GGTGTTGCGCTGCAACTG 3′ AfllkhA NotI_R
      OHS407 GATATGTCGCCACACTGGAC AflbrlA RT_F
      OHS408 CTGTATTCGCGGCTATTCGG AflbrlA RT_R
      OHS409 CTTCCGCACCTTAACAGCAG AflabaA RT_F
      OHS410 GTTTGCCGGAATTGCCAAAG AflabaA RT_R
      OHS405 TATGTCGGTGATGAGGCACA Aflactin RT_F
      OHS406 AACACGGAGCTCGTTGTAGA Aflactin RT_R
      Table 1. Aspergillus flavus strains used in this study

      Table 2. Primers used in this study

      Tail sequences are shown in italics. Restriction enzyme sites are presented in bold.


      Journal of Microbiology : Journal of Microbiology
      TOP