Skip Navigation
Skip to contents

Journal of Microbiology : Journal of Microbiology

OPEN ACCESS
SEARCH
Search

Articles

Page Path
HOME > J. Microbiol > Volume 63(4); 2025 > Article
Full article
Antifungal effects of Metformin against Candida albicans by autophagy regulation
Xiao Zhao1,2,3, Yang Wang1,2,3, Qinqin Zhang1,2,3, Yun Huang1,2,3, Xin Wei1,2,3,*, Daming Wu1,2,3,*
Journal of Microbiology 2025;63(4):e2411008.
DOI: https://doi.org/10.71150/jm.2411008
Published online: April 29, 2025

1Department of Endodontics, The Affiliated Stomatological Hospital of Nanjing Medical University, Nanjing 210000, P. R. China

2Jiangsu Province Engineering Research Center of Stomatological Translational Medicine, Nanjing 210000, P. R. China

3State Key Laboratory Cultivation Base of Research, Prevention and Treatment for Oral Diseases, Nanjing 210000, P. R. China

*Correspondence Xin Wei weixinart@163.com Daming Wu wdming@njmu.edu.cn
• Received: November 5, 2024   • Revised: January 7, 2025   • Accepted: January 22, 2025

© The Author(s), under exclusive licence to Microbiological Society of Korea 2026

This is an Open Access article distributed under the terms of the Creative Commons Attribution 4.0 International License (CC BY 4.0) (https://creativecommons.org/licenses/by/4.0/) which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 2,584 Views
  • 113 Download
  • 6 Web of Science
  • 6 Crossref
  • 6 Scopus
  • Candida albicans (C. albicans) is a common opportunistic fungal pathogen that can cause infections ranging from superficial to severe systemic diseases. This study investigates the antifungal effects of metformin on C. albicans and explores its underlying mechanisms. Growth inhibition was assessed via XTT assays, and hyphal formation and morphological changes were observed by light microscope and scanning electron microscopy (SEM). Mitochondrial membrane potential (MMP) and reactive oxygen species (ROS) levels were measured with JC-1 and DCFH-DA probes, respectively. Gene expression related to ROS and autophagy was quantified by RT-qPCR, and autophagosomes were visualized using transmission electron microscopy (TEM). Metformin significantly inhibited C. albicans growth and hyphal formation, altered cell morphology, reduced MMP, and increased ROS levels. It activated autophagy in planktonic C. albicans but suppressed it in biofilm forms. Additionally, metformin exhibited synergistic effects with amphotericin B against planktonic C. albicans and with caspofungin against biofilms. The findings suggest that metformin exerts antifungal activity by modulating MMP, ROS levels, and autophagy-related pathways, and enhances the efficacy of specific antifungal drugs.
Candida albicans (C. albicans) is a major opportunistic fungal pathogen in humans, commonly residing in the oral cavity, gastrointestinal tract, and vagina (Luther et al., 2023). While it often causes superficial infections, C. albicans poses significant risks to immunocompromised individuals, including patients with AIDS, those undergoing chemotherapy, or organ transplant recipients, resulting in high morbidity and mortality rates (d'Enfert et al., 2021; Koshikawa et al., 2022). Additionally, C. albicans has the ability to form biofilms on host tissues and medical devices surfaces. These biofilms consist of yeast, pseudo mycelium, and hyphal cells embedded in an extracellular matrix, exhibiting a highly organized structure (Osset-Trénor et al., 2023; Pereira et al., 2021). Biofilms confer enhanced resistance to environmental stressors and antifungal agents, exhibiting resistance levels significantly higher than those required to target planktonic cells (Mathé and Van Dijck, 2013; Rabaan et al., 2023). This heightened resistance poses a significant challenge for traditional antifungal treatments, particularly in eradicating Candida biofilms.
The development of novel antifungal drugs is arduous for difficulties related to toxicity, pharmacokinetic complexities, and high costs. To address these obstacles, drug repurposing was proposed, which identifies new use for approved or developing drugs that are outside the scope of the original medical indication (Moraes and Ferreira-Pereira, 2019). Several non-antifungal drugs have demonstrated antifungal activity or enhanced the efficacy of antifungal drugs when used in combination (Barbarossa et al., 2023; Lin et al., 2023; Moraes and Ferreira-Pereira, 2019). Metformin is an oral medication commonly used for the treatment of type 2 diabetes (Podhorecka et al., 2017). Recent studies reveal that metformin not only affects metabolic pathways but also influences cellular autophagy levels by modulating related signaling pathways such as AMPK/mTOR (AMP-activated protein kinase / mechanistic target of rapamycin) (Bridges et al., 2014; González et al., 2020; Lv and Guo, 2020). Autophagy, a cellular mechanism for degradation and resource recycling, is widely conserved among eukaryotes (Miceli et al., 2023). In microorganisms, it acts as a vital stress response, helping cell adapt to challenging conditions like nutrient deprivation and oxidative stress (Bekbulat, 2023). Studies indicate that metformin, under specific conditions such as hypoxia or in cancer cells, can inhibit autophagy by modifying the intracellular metabolic state or interacting with other signaling pathways (Lee et al., 2023; Lu et al., 2021).
C. albicans utilize autophagy to adapt to unfavorable conditions, such as nutrient scarcity and oxidative stress (Du et al., 2022; Wójcik-Mieszawska et al., 2023). Through this process, C. albicans regulates intracellular nutrient acquisition and maintains metabolic balance, enabling survival under stressful conditions (Du et al., 2023). Previous studies have shown that antifungal agents can influence C. albicans autophagy (Shen et al., 2023). However, whether metformin affects C. albicans by modulating autophagy remains unclear. Research has demonstrated that metformin enhances the susceptibility of tetracycline-resistant E. coli to tetracycline (Liu et al., 2020), and exhibits antifungal activity against C. glabrata in combination with voriconazole, fluconazole, and amphotericin (Xu et al., 2018). However, no studies have yet explored the effects and mechanisms of metformin on C. albicans. This study aims to investigate the effects of metformin on the growth of C. albicans in both planktonic and biofilm states, examine its potential antifungal mechanism through autophagy modulation, and evaluate its efficacy when combined with other antifungal drugs.
Experimental strains
The C. albicans standard strain (SC5314, ATCC VR MYA2876TM) was purchased from the American Type Culture Collection (ATCC, USA) and stored at -80℃ until needed. Yeast cells were subcultured on Sabouraud dextrose agar (SDA, Hope Bio-Technology Co., Ltd., China) plates, and a fresh single colony was selected and inoculated into YPD liquid medium (Sigma, USA). The culture was incubated overnight at 30°C with shaking at 210 rpm. A 1 ml fungal suspension was collected in a 1.5 ml Eppendorf tube, centrifuged at 2,100 × g for 5 min, and the supernatant discarded. The pellet was washed thrice with PBS and resuspended in PBS to obtain the C. albicans suspension.
Drugs
All drugs (metformin, fluconazole, itraconazole, amphotericin B, caspofungin, 5-fluorocytosine, and terbinafine) were procured from Sigma. Drug solutions were prepared according to Clinical and Laboratory Standards Institute guidelines (CLSI, 2017). Metformin, fluconazole, caspofungin, and 5-fluorocytosine were dissolved in sterile distilled water to achieve the required concentrations. Itraconazole, amphotericin B, and terbinafine were prepared in dimethyl sulfoxide (DMSO) (Sigma, USA). All solutions were stored at -20°C until use.
Minimal inhibitory concentration 80% (IC80) of metformin against planktonic C. albicans
The IC80 refers to the lowest concentration of a compound required to inhibit 80% of microbial growth under specific conditions. In this study, the IC80 of metformin against planktonic C. albicans was determined using broth microdilution and XTT assays (Chen et al., 2024). Briefly, C. albicans suspension was diluted to 2 × 103 CFU/ml with RPMI-1640 medium (Sigma, USA), adjusted to pH 7.0 using MOPS buffer (Sigma, USA). A 100 μl of this suspension and add it to a 96-well plate containing 100 μl of serial 2-fold diluted metformin, with concentrations from 0. 5 to 128 mg/ml, and set control wells (the biofilm without metformin). After incubation at 37℃ for 24 h in a CO2 incubator (ESCO, Singapore), 100 μl of the suspension was transferred to a new 96-well plate. Then, 100 μl of XTT solution (Invitrogen, USA) was added, and the plate was incubated in the dark for 2 h. Absorbance was measured at 492 nm using a microplate reader, and the IC80 was calculated.
Sessile minimal inhibitory concentration 50% (IC50 of biofilm formation) of metformin against C. albicans biofilm
The method for determining the IC50 of metformin against mature biofilms was similar to that for IC80. Briefly, C. albicans suspension was adjusted to 1.0 × 106 CFU/ml and seeded into 96-well plates, followed by incubation at 37℃. After 2 h, the medium was aspirated, and the wells were washed thrice with sterile PBS to remove non-adherent fungi. The fungi were then incubated for an additional 24 h. 100 μl serial 2-fold dilutions of the metformin, ranging in concentration from 0. 5 to 128 mg/ml, were dispensed into the 96-well plates, while the control biofilms without metformin were established accordingly. Following incubation at 37℃ for another 24 h, the susceptibilities of the biofilms were assessed using the XTT assay. Biofilm growth was quantified by measuring absorbance at 492 nm using a microplate reader and calculate IC50 of biofilm formation. All experiments were conducted thrice.
Time-kill curve assay of metformin against C. albicans
To examine the effects of concentration and exposure duration, a time-kill assay was performed to assess the antifungal effects of metformin on C. albicans in planktonic and biofilm (Zhou et al., 2012). Briefly, C. albicans suspension was diluted to 1 × 103 CFU/ml in RPMI 1640 medium with metformin (1/2 IC80, IC80, 2 IC80, and 4 IC80) in 96-well plates. As described above, mature biofilms were cultivated in 96-well plates. Following this, the medium was removed, and biofilms were washed twice with PBS. Subsequently, 100 μl of metformin at concentrations equivalent to 1/2 IC50, IC50, 2 IC50, and 4 IC50 of biofilm formation was added to the RPMI 1640 medium. The control biofilms without metformin were set up accordingly. During the experiment, all samples were incubated at 37°C in a CO2 incubator. At designated time points (0, 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, and 72 h), the XTT assay was used to assess fungal susceptibility, as described above.
Hyphae growth assay of C. albicans
To assess the effect of metformin on hyphal growth, RPMI 1640 medium, which induces hyphae formation, was used. C. albicans (5.0 × 105 CFU/ml) were suspended in medium supplemented with metformin concentrations of 8, 16, 32, 64, and 128 mg/ml, then plated onto 24-well tissue culture plates. Following a 3 h incubation at 37℃ in a CO2 incubator, cell morphology was captured using the light microscope. Then the mycelial inhibition rate was calculated by measuring mycelial length.
Scanning electron microscope (SEM)
After co-culture with different concentrations of metformin, C. albicans in planktonic and biofilm were washed thrice with PBS and fixed in 2.5% glutaraldehyde overnight at 4℃. The samples were dehydrated in different concentrations of ethanol (30, 50, 70, 80, 90, and 100%) gradient, with each step lasting 15 min, followed by freeze-drying. Subsequently, the dried samples were affixed to conductive adhesive, mounted onto copper sample holders, and sputter-coated with gold under vacuum conditions. Morphological observations were performed using SEM (LEO, Germany).
Mitochondrial membrane potential (MMP) measurement
To evaluate changes in MMP, the fluorescent probe JC-1 were used. Planktonic C. albicans were adjusted to 1 × 103 CFU/ml, and mature biofilm were adjusted to 1 × 106 CFU/ml. Both were treated with different concentrations of metformin at 37˚C for 4 h. Subsequently, the cells were stained with 10 μmol/L JC-1 at 37˚C for 30 min in the dark according to instructions. Fluorescence measurements were performed for JC-1 monomers (excitation: 514 nm, emission: 529 nm) and JC-1 polymers (excitation: 585 nm, emission: 590 nm). The ratio of fluorescence intensities was calculated to assess changes in MMP.
ROS level detection
ROS levels were determined using fluorescence microscopy and the probe 2',7'-Dichlorodihydrofluorescein diacetate (DCFH-DA). For planktonic C. albicans, cells were diluted to 1 × 106 CFU/ml in medium and exposed to varying metformin concentrations at 37℃ for 4 h. For C. albicans biofilm, mature biofilms cultured on 96-well plates were treated with metformin under the same conditions. Negative controls were incubated without metformin at the same condition. After incubation, all groups were washed twice with PBS buffer and stained with 10 μmol/L DCFH-DA at 37℃ for 30 min in the dark. Then, they were washed thrice with PBS, and read relative fluorescence intensity values with a fluorescence microplate reader.
RT-qPCR
The expression of ROS related genes (trr1, sod1-5, cat1-2, and glr1) and autophagy related genes (atg1-10, atg12-13, atg16-17, atg27, and ccz1) were evaluated by the quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR). Both planktonic and biofilm states of C. albicans were treated with varying concentrations of metformin. Total RNA was extracted with Trizol reagent (Invitrogen, USA), followed by cDNA synthesis using a kit (TaKaRa Bio, China) as per the manufacturer’s instructions. The resulting cDNA was stored at -80°C until required. Subsequently, real-time PCR analysis was performed on an ABI 7300 Fast Real-time PCR machine (Applied Biosystems, Switzerland) using Absolute qPCR SYBR Green Mix (Thermo Scientific, USA). The PCR amplification protocol consisted of an initial denaturation step at 95℃ for 10 min, followed by 40 cycles of denaturation at 95℃ for 15 s, annealing at 55℃ for 60 s, and extension at 72℃ for 20 s. After amplification, a melting curve analysis was conducted to confirm the absence of primer dimers. Gene expression levels were quantified using the 2-ΔΔCt method with act1 serving as the internal reference gene (Yu et al., 2011). Primer design was outsourced to Shanghai Generay BioTech Co., Ltd. The primers and sequences are listed in Tables 1 and 2. The experiment was conducted thrice.
Transmission electron microscopy (TEM) observation
After co-culture with metformin, C. albicans cells in planktonic and biofilm were washed thrice with PBS and placed in 2.5% glutaraldehyde overnight at 4℃. Subsequently, the fungi, both planktonic and biofilm, were treated with 1% osmium tetroxide for 2 h at 4℃. Sequentially, ethanol dehydrated steps (30, 50, 70, 80, 95, and 100%) were performed, followed by embedding the cells in epoxy resins, sectioning, and staining. Finally, the samples were examined using TEM (JEM-2100, JEOL, Japan).
Interaction between metformin and antifungal drugs
The synergistic effects of metformin in combination with antifungal drugs (fluconazole, itraconazole, caspofungin, amphotericin B, terbinafine, and 5-flucytosine) were evaluated using a microdilution checkerboard technique and XTT assay. For planktonic C. albicans, 50 μl of a 2-fold concentration of antifungal drugs was added to columns 1–11, while 50 μl of a 2-fold concentration of metformin was added to rows A–G of microtiter plates, and 100 μl solution with final yeast concentrations of 1 × 103 CFU/ml. Final drug concentrations ranged from 0.0315 to 16 μg/ml for fluconazole, itraconazole, amphotericin B, and 5-flucytosine; from 0.25 to 128 μg/ml for terbinafine; and 0.5 to 128 mg/ml for metformin. Two control groups (biofilm with and without metformin) and blank wells (no biofilm or drug) were included. Plates were incubated at 37°C for 24 h. Survival rates were assessed using XTT assays. For the C. albicans biofilm, mature biofilms in 96-well plates were prepared as previously described. After aspiration of the medium and washing of biofilms with PBS, 50 μl of a 2-fold concentration of antifungal drugs was added to columns 1–11, and 50 μl of a 2-fold concentration of metformin was added to rows A–G. Antifungal drug concentrations ranged from 0.0315 to 16 μg/ml for itraconazole and amphotericin B, from 0.125 to 64 μg/ml for fluconazole and 5-fluorocytosine, and from 0.25 to 128 μg/ml for caspofungin and terbinafine. Metformin concentrations were the same as for planktonic C. albicans. Following incubation at 37℃ for 24 h, XTT assays were conducted to determine the IC. The fractional inhibitory concentration index (FICI) was used to characterize the synergistic effect between metformin and antifungal drugs against C. albicans in planktonic and biofilm (Barbarossa et al., 2024; Sturaro et al., 2024). The FICI was described using the following equation:
FICI=FICA+FICB=CA/ICA+CB/ICB
In the formula above, ICA and ICB are respectively the IC50 when drug A and drug B act alone, while CA and CB are the IC50 when drug A and drug B are used in combination to achieve the same effect. Synergism, additivity, indifference, and antagonism were defined based on FICI values: FICI ≤ 0.5 (synergism), 0.5 < FICI ≤ 1 (additivity), 1 < FICI ≤ 2 (indifference), and FICI > 2 (antagonism).
Statistical analysis
Statistical analysis was conducted using IBM SPSS statistical software (version 22.0). Results were presented as the mean values ± standard deviation (SD). One-way analysis of variance (ANOVA) followed by Fisher LSD’s post hoc test was employed for data analysis and subsequent comparisons. Statistical significance was set at p < 0.05.
Antifungal activity of metformin against C. albicans
Two states of C. albicans were treated with different concentrations of metformin. The IC80 of metformin inhibiting 80% growth of planktonic C. albicans was 16 mg/ml and the IC50 of metformin inhibiting 50% growth of C. albicans biofilm was 64 mg/ml (Fig. 1A).
Next, in planktonic cells, 1/2 IC80, IC80, 2 IC80, and 4 IC80 were used, with concentrations of 8, 16, 32, and 64 mg/ml, respectively. In biofilm, 1/2 IC50, IC50, 2 IC50, and 4 IC50 were used, with concentrations of 32, 64, 128, and 256 mg/ml, respectively. In planktonic state, metformin reduced the time-kill curve slope of C. albicans compared with the control group, and the greater the concentration, the more significant the reduction was (Fig. 1B). Similarly, in biofilm state, the time-kill curve slope of control group was positive, while that of the metformin against C. albicans was negative and decreased with the increase of metformin concentration (Fig. 1C).
Inhibition by metformin on hyphal development of C. albicans
We evaluated the effects of metformin on the hyphal development of C. albicans. C. albicans developed elongated and regular hyphae without metformin treatment. However, the formation of hyphae was partially inhibited with 8 and 16 mg/ml metformin treatment. Notably, hyphae development was further significantly inhibited after treatment with 32, 64, and 128 mg/ml of metformin (Fig. 2A). The results of hyphae length inhibition rate indicated that metformin impeded the growth of C. albicans hyphae (p < 0.001), and the inhibition was dose-dependent (Fig. 2B).
Changes by metformin on the morphology of C. albicans
For planktonic C. albicans, SEM observation showed that compared to the control group, the cell of metformin-treated group appeared rough surfaces, collapsed, and shrinkage (Fig. 3A). For biofilm, SEM observation showed that compared with control group, the surface of biofilm treated with metformin became rough, and the biofilm appeared remarkably morphologically damaged with visible shrinkage, collapse, and bulge (Fig. 3B).
Effects of metformin on MMP of C. albicans
MMP changes in C. albicans were determined by the fluorescent probe JC-1. In normal mitochondria, JC-1 forms a JC-1 aggregate in the mitochondria and emits red fluorescence; otherwise, it exists as a JC-1 monomer in the cytosol and emits green fluorescence. The results showed that the red fluorescence of C. albicans in planktonic and biofilm was weakened, while the green fluorescence was enhanced after metformin treatment (Fig. 4A and 4C). The ratio of JC-1 aggregates (red fluorescence) to JC-1 monomers (green fluorescence) decreased (p < 0.05) in a dose-dependent manner (Fig. 4B and 4D).
Effects of metformin on ROS levels and related genes expression in C. albicans
For planktonic cells, compared to the control group, the 16 and 32 mg/ml metformin-treated groups produced more ROS (p < 0.01) (Fig. 5A). In addition, the expressions of some antioxidant-related genes were down-regulated after metformin treatment. In the 8 and 32 mg/ml metformin treatment groups, the gene expression of trr1 was significantly reduced compared to the control group (p < 0.05). Similarly, the expressions of sod1-2 and sod4 were lower in metformin-treated groups compared to the control group (p < 0.001). There were no statistically significant differences in the expression of other genes (Fig. 5B).
For biofilm, compared control group, the 128 mg/ml metformin group produced more ROS (p < 0.001) (Fig. 5C). In addition, the expressions of some antioxidant-related genes were up-regulated or down-regulated after metformin treatment. The gene expression of trr1 in 64 mg/ml metformin-treated group was elevated compared to that in the control group (p < 0.001), the gene expressions of sod1 and sod5 in 32, 64, and 128 mg/ml metformin-treated groups were lower than that in the control group (p < 0.001), and the expression of other genes had no statistical difference (Fig. 5D).
Autophagy-related genes expression in C. albicans
Figure 6A presented the expression changes of 16 autophagy-related genes in planktonic C. albicans. In the 8 mg/ml metformin-treated group, atg1-10 expressions were up-regulated compared to the control (p < 0.001). At 16 mg/ml, atg1, atg3, atg5, atg6, and atg8 were up-regulated (p < 0.001), while atg12-13, atg16-17, atg27, and ccz1 were down-regulated compared to the control (p < 0.05). In the 32 mg/ml group, Atg1-4, Atg6-7, and Atg10 were up-regulated (p < 0.01), while Atg8, atg12-13, atg27, and ccz1 were down-regulated compared to the control (p < 0.05). Figure 6B showed gene expression changes in C. albicans biofilms. In the 32 and 64 mg/ml metformin-treated groups, all 16 autophagy-related genes were downregulated compared to the control (p < 0.001). At 128 mg/ml, except for atg3, Atg7, and atg16, the other 13 genes were downregulated compared to the control (p < 0.001).
Autophagosomes observation in C. albicans
TEM images revealed that planktonic C. albicans treated with 16 mg/ml metformin exhibited more double-membrane autophagosomes than the control group, indicating that metformin promoted autophagosome formation in planktonic cells (Fig. 7A). In contrast, C. albicans biofilm treated with 64 mg/ml metformin displayed fewer autophagosomes, whereas the untreated biofilm exhibited more autophagosomes (Fig. 7B), suggesting that metformin reduced autophagosome formation in biofilm cells.
Interactions between metformin and antifungal drugs against C. albicans in planktonic and biofilm
For planktonic C. albicans, various antifungal drugs combined with metformin showed a synergistic effect when used with amphotericin B and an additive effect with itraconazole. Additionally, fluconazole, caspofungin, and terbinafine in combination with metformin showed indifferent effects, while 5-fluorocytosine exhibited an antagonistic effect when used with metformin (Fig. 8AF, Table 3). For C. albicans biofilm, a synergistic effect existed when caspofungin-combined with metformin, while fluconazole, itraconazole, and amphotericin B had an additive effect when combined with metformin. Furthermore, the combination of 5-fluorocytosine and terbinafine with metformin exhibited indifferent effects (Fig. 8GL, Table 3).
Increasing the dosage of antifungal drugs to address drug-resistant C. albicans infections in clinical practice not only increases side effects but also accelerates C. albicans resistance and raises costs (Todd et al., 2023). Drug repositioning and combined use may reduce the drug side effects and cost (Efentakis et al., 2024; Moraes and Ferreira-Pereira, 2019). This study evaluated the antifungal activity of metformin against both planktonic and biofilm states of C. albicans, exploring its potential mechanisms of action and effects when combined with antifungal drugs. Biofilms are intricate 3D structures consisting of microbial cell community surrounded by an extracellular polysaccharide substance (Pereira et al., 2021; Wall et al., 2019). Research indicates that microbial cells within biofilms are 10 to 100 times more resistant to antibiotics than planktonic cells (Sharma et al., 2019). Consistent with this, in our study, the IC50 of metformin for planktonic C. albicans was 4 mg/ml, while the IC50 for C. albicans biofilm was 64 mg/ml, 16 times that of planktonic cells, further confirming this phenomenon. Moreover, although the in vitro drug concentrations required for biofilm clearance may seem high, it is important to note that drug concentrations required for effective in vivo treatment may be lower than in vitro due to the host immune response and tissue interactions (Kher and Santoro, 2023; Vyas et al., 2022), and the used concentration in vivo might be far lower than 64 mg/ml.
The time-kill curve remains approximately horizontal when the drug has an inhibitory effect, while the slope of the curve is negative when the drug exerts a bactericidal effect (Bren et al., 2023; Zhang et al., 2023). In this experiment, when planktonic C. albicans was treated with 8, 16, or 32 mg/ml of metformin, the time-kill curve remained approximately horizontal and then gradually increased, indicating that metformin showed inhibitory effects on the planktonic C. albicans. Xu et al. (2018) showed that metformin can inhibit planktonic C. glabrata, which is consistent with the results of metformin on planktonic C. albicans in this experiment. However, at 64 mg/ml, metformin appeared to have fungicidal effects on planktonic cells, as no C. albicans regeneration was observed in 72 h. Moreover, the time-kill curve for C. albicans biofilms treated with 32, 64, or 128 mg/ml of metformin showed a negative slope. The slopes of the time-kill curves of the 128 and 256 mg/ml metformin-treated groups were significantly reduced compared to the 32 and 64 mg/ml metformin-treated groups. These results showed that metformin had a fungicidal effect on C. albicans biofilm in a dose-dependent manner. The results of the time-kill curves of metformin on planktonic cells and biofilms are not entirely the same due to the different biological properties of C. albicans in these two states, which lead to different responses to external stimuli.
The effect of metformin on the morphology of C. albicans was assessed using the hyphae formation assay and SEM. Results indicated a dose-dependent inhibition of hyphae formation by metformin. Treatment with 32, 64, and 128 mg/ml metformin completely inhibited hyphae formation, maintaining the yeast form. Hyphae formation in C. albicans is associated with virulence factors such as adhesion, biofilm formation, and invasiveness (Krysan, 2023). Thus, metformin's inhibition of hyphal growth may reduce the virulence of the fungus. Additionally, SEM analysis revealed that C. albicans in planktonic and biofilm treated with metformin exhibited rough surfaces, collapse, shrinkage, bulging, and other morphological changes in a dose-dependent manner.
Mitochondrial complex I inhibition is a well-established mechanism of metformin action in cells (Abrosimov et al., 2024; Yang et al., 2021). In this study, we used the JC-1 fluorescent probe to detect the MMP of C. albicans treated with metformin (Carrageta et al., 2022). JC-1 selectively localizes to mitochondria, where its fluorescence properties shift with changes in MMP. In healthy mitochondria with intact MMP, JC-1 forms aggregate that emit red fluorescence. When MMP decreases, JC-1 exists as monomers, emitting green fluorescence. Our findings demonstrated that after treatment with metformin, the MMP of C. albicans decreased and green fluorescence increased. A reduction in MMP is generally associated with a decrease in the efficiency of the electron transport chain, leading to electron leakage and the formation of more ROS (Bagkos et al., 2014; Zhao et al., 2024). We further detected ROS levels in C. albicans using the DCFH-DA fluorescence probe, and the results showed that the ROS levels in the metformin groups were higher than in the control group, which is consistent with the decrease in MMP. In tumor cells, the MMP changes caused by metformin through complex I inhibition are considered one of its anticancer mechanisms, as they limit the ability of tumor cells to respond to external pressures and stimuli (Catalano et al., 2023; Sun et al., 2024). Additionally, metformin has been reported to inhibit the growth of C. elegans by inhibiting mitochondrial respiration (Chen et al., 2017). The mitochondrial dysfunction observed in C. albicans in this study parallels the effects of metformin on the mitochondria of cancer cells and C. elegans, suggesting a conserved mechanism of action.
Antioxidant genes such as sod1-5, trr1, cat1-2, and glr1 are upregulate, playing a crucial role in clearing ROS and repairing oxidative damage when ROS level in C. albicans increases (Feng et al., 2022; Kang and Kwak, 2021). However, this study showed that after treatment with metformin, the expression of the sod1 gene was downregulated in both planktonic cells and biofilms, which may affect the clearance of ROS and the repair of oxidative damage in C. albicans. Therefore, Both the decreased MMP and the downregulation of antioxidant genes may explain the increased ROS levels in C. albicans after treated with metformin. In biofilm, after treatment with 64 mg/ml metformin, the expression of trr1 was upregulated, which may be a stress response of C. albicans biofilm to increased ROS. After metformin treatment, the expression of sod3, cat1-2, and glr1 in both planktonic and biofilm forms showed no significant changes, which may due to the influence of metformin on ROS clearance and oxidative damage repair in C. albicans.
Autophagosomes are membrane-enclosed vesicles, typically appearing as round or oval structures under TEM, with a size range of 300–900 nm. Their interior contains degraded intracellular material, which typically appears darker (Yang et al., 2022). Autophagy plays a crucial role in maintaining cellular homeostasis (Sengking and Mahakkanukrauh, 2024), and metformin exerts its pharmacological effects through autophagy (Fang et al., 2023; Gao et al., 2020; Zhao et al., 2019). In this study, we used RT-qPCR and TEM to examine autophagy in C. albicans after metformin treatment. The results showed that metformin had different effects on autophagy in planktonic and biofilm forms of C. albicans: autophagy was activated in planktonic C. albicans, whereas it was inhibited in C. albicans biofilm. This difference may be attributed to the baseline difference in autophagy levels between the two states. Previous studies have shown that the autophagy level in C. albicans biofilm is higher than in its planktonic state (Liu et al., 2022; Shen et al., 2023). In the planktonic state, metformin may lead to overactivation of autophagy, thereby affecting cell growth. In the biofilm state, due to the typically low-oxygen or even hypoxic microenvironment, metformin may inhibit the autophagy pathway, thereby affecting the survival of the cells.
In vitro studies have shown that metformin increases the susceptibility of C. glabrata to azole drugs (Xu et al., 2018). Therefore, we investigated the effect of metformin combined with antifungal drugs to determine whether it could reduce the effective concentration of both drugs against C. albicans. The FICI method, based on IC50 calculations, was used to evaluate the combined effects of the drugs. This method is widely recognized for its simplicity, practicality, and reliability (Li et al., 2015). In this study, metformin exhibited synergistic effects with amphotericin B against planktonic C. albicans and with caspofungin against C. albicans biofilm. These findings suggest that metformin, when combined with specific antifungal drugs, can reduce toxicity and enhance the therapeutic effects of both agents. However, metformin combined with 5-fluorocytosine showed an antagonistic effect against planktonic C. albicans and an indifferent effect against C. albicans biofilm. These results indicate that the combination of metformin with antifungal drugs should be carefully considered, and 5-fluorocytosine should be avoided in such combinations.
In conclusion, metformin exhibits anticandidal effects on both planktonic and biofilm forms of C. albicans, including the inhibition of hyphal formation. Its mechanisms involve reducing MMP, increasing ROS levels, and modulating autophagy. Additionally, metformin demonstrates synergistic effects when combined with amphotericin B against planktonic C. albicans and with caspofungin against C. albicans biofilm.
Fig. 1.
Antifungal activity of metformin against C. albicans. (A) Survival rate of C. albicans in planktonic and biofilm after treatment with metformin at different concentrations. (B) The time-kill curves of metformin against planktonic C. albicans. (C) The time-kill curves of metformin on C. albicans biofilms.
jm-2411008f1.jpg
Fig. 2.
Effects of metformin on hyphal development of C. albicans. (A) The images of the hyphal development of C. albicans treated by different concentrations of metformin. (B) The hyphal inhibition rate of C. albicans after the treatments of different concentrations of metformin. ***p < 0.001.
jm-2411008f2.jpg
Fig. 3.
SEM images of C. albicans in planktonic and biofilm. (A) Treatment of planktonic C. albicans with different concentrations of metformin. (B) Treatment of C. albicans biofilms with different concentrations of metformin. Arrows 1 indicates rough surface, 2 indicates collapse, 3 indicates shrinkage, 4 indicates bulge.
jm-2411008f3.jpg
Fig. 4.
MMP detection of C. albicans in planktonic and biofilm. (A, B) Fluorescence images of MMP and ratio of JC-1 aggregates to JC-1 monomers in planktonic C. albicans after metformin treatment. (C, D) Fluorescence images of MMP and ratio of JC-1 aggregates to JC-1 monomers in C. albicans biofilms after metformin treatment. *p < 0.05, ***p < 0.001.
jm-2411008f4.jpg
Fig. 5.
Detection of ROS levels and related genes expression in C. albicans. (A) ROS levels in planktonic C. albicans and (B) expression levels of antioxidant-related genes. (C) ROS levels in C. albicans biofilm and (D) expression levels of antioxidant-related genes. *p < 0.05, **p < 0.01, ***p < 0.001.
jm-2411008f5.jpg
Fig. 6.
Effects of metformin on autophagy-related genes expression in C. albicans. (A) Expression of autophagy related genes in planktonic C. albicans. (B) Expression of autophagy related genes in C. albicans biofilm. *p < 0.05, **p < 0.01, ***p < 0.001.
jm-2411008f6.jpg
Fig. 7.
TEM images of C. albicans autophagosomes. (A) TEM images of planktonic C. albicans in the control group and treated with 16 mg/ml metformin. (B) TEM images of C. albicans biofilm in the control group and treated with 64 mg/ml metformin. The red arrow represents autophagosome.
jm-2411008f7.jpg
Fig. 8.
Metformin combined with various antifungal drugs for the treatment of C. albicans in planktonic and biofilm. (A–F) Planktonic C. albicans, including (A) fluconazole, (B) itraconazole, (C) amphotericin B, (D) caspofungin, (E) 5-fluorocytosine, and (F) terbinafine. (G–L) C. albicans Biofilm, including (G) fluconazole, (H) itraconazole, (I) amphotericin B, (J) caspofungin, (K) 5-fluorocytosine, and (L) terbinafine.
jm-2411008f8.jpg
Table 1.
Primer sequences of ROS related genes used in the present study
Genes Sequence (5’→3’)
trr1 F: GACCAACTCAAGACCGACGAAGC
R: GCCATACATCCACTACCAGCAGAAG
sod1 F: ACAAGAATCCGAATCCGCTCCAAC
R: AGGACCAGCAGAAGTACAACCATTG
sod2 F: GAACAAGCCGTTGAAGCCAA
R: ACCTTGAGAGACAGGAGCCA
sod3 F: CCAAGGATCAGGTTGGGCAT
R: AGTACGCATGTTCCCAAGCA
sod4 F: ACGATACTGCAAGTGCTGCT
R: CAGCACCGCTACCTTGAGAA
sod5 F: ACTTTGCTTGACGAGGGACA
R: CAGCGCCATTACCTTGAGGA
cat1 F: CCAATTCCAGAACCATTTGCCACTC
R: ACCATAAGCACCGGAACCTTTAGC
cat2 F: TCAAGAATGGACGCCACACC
R: TTCTTCATCGTGGGCAGCAA
glr1 F: TGACAAGACTTTGATCGCCACTGG
R: TCCAAGGCAAAGAACCCATCAGATG
β-actin F: GACCAAGAAGACATCAAGGTATCAT
R: GTGTTCAATTGGGTATCTCAAG
Table 2.
Primer sequences of autophagy related genes used in the present study
Genes Sequence (5’→3’)
atg1 F: TACAACCCAACTGAGCGGAT
R: GTAGTGGGTGATGGGCTTCT
atg2 F: GCCAAGACTACGGGGTATGA
R: GCCAAGACTACGGGGTATGA
atg3 F: AACGTGGCAATGGGGTAATG
R: CGTCCTCCTCTTCCTCTTCC
atg4 F: AGTGGTAGAGACGCCAATCA
R: GCACCGGTAATGTATGTGGG
atg5 F: CATGACTTGGGTTGCTGGAC
R: TGTTGGCTTCACTCAATTGCA
atg6 F: GCCAGAAATCAATGCCGCAT
R: CCATCTACTGCATCCTTGGC
atg7 F: CTGGGGTGTCAGGAGCATTA
R: GCATCTACACCGGGGAAAAC
atg8 F: GCCAGAATTGCTCAGAGG
R: GATTAATGCAGCGGTTGG
atg9 F: TACCGCAACACCAACAACAA
R: CTCCGTTTCAATTGGGGTGG
atg10 F: GAACGTTGGCAGTTGGGATT
R: AACCCGTATAGCCCAAACCA
atg12 F: ACAAGACCCAATCCCAACCA
R: TGGTTGAATCGACGGTGTTG
atg13 F: AGTGTCCCGTCGTCTTCA
R: ATGGAATCCTCATGACCCG
atg16 F: CCTTTTGGGACATCATTCTTCG
R: GCGCATCGAAGACATACGA
atg17 F: CCATCGGAGTTCAAGCTTCC
R: TCCGGTGATCATGTCCATCA
atg27 F: GCCACCTTCGCAAACAAA
R: TGAAACCAAGCACCACCA
ccz1 F: TGTCTCCCAAAGCCGAATCT
R: GTTGTTGTGGACGTGGTTGA
Table 3.
The interactions between metformin and antifungals on C. albicans using the FICI model
Drug combination with metformin Planktonic
Biofilm
FICI Interpretation FICI Interpretation
Fluconazole 2 IND 1 ADD
Itraconazole 0.75 ADD 0.75 ADD
Amphotericin B 0.375 SYN 1 ADD
Caspofungin 1.5 IND 0.125 SYN
5-Fluorocytosine 3 ANT 1.5 IND
Terbinafine 1.125 IND 1.25 IND

SYN: synergism; ADD: additivity; IND: indifference; ANT: antagonism

  • Abrosimov R, Baeken M, Hauf S, Wittig I, Hajieva P, et al. 2024. Mitochondrial complex I inhibition triggers NAD+-independent glucose oxidation via successive NADPH formation, "futile" fatty acid cycling, and FADH2 oxidation. GeroScience. 46(4): 3635–3658. ArticlePubMedPMCPDF
  • Bagkos G, Koufopoulos K, Piperi C. 2014. A new model for mitochondrial membrane potential production and storage. Med Hypotheses. 83(2): 175–181. ArticlePubMed
  • Barbarossa A, Rosato A, Carrieri A, Fumarola L, Tardugno R, et al. 2024. Exploring the antibiofilm effect of sertraline in synergy with Cinnamomum verum essential oil to counteract Candida species. Pharmaceuticals. 17(9): 1109.ArticlePubMedPMC
  • Barbarossa A, Rosato A, Carrieri A, Tardugno R, Corbo F, et al. 2023. Antifungal biofilm inhibitory effects of combinations of diclofenac and essential oils. Antibiotics. 12(12): 1673.ArticlePubMedPMC
  • Bekbulat F. 2023. Evolutionarily acquired response of selective autophagy receptors provides resilience against oxidative stress. Bioessays. 45(11): e2300168. ArticlePubMed
  • Bren A, Glass DS, Kohanim YK, Mayo A, Alon U. 2023. Tradeoffs in bacterial physiology determine the efficiency of antibiotic killing. Proc Natl Acad Sci USA. 120(51): e2312651120. ArticlePubMedPMC
  • Bridges HR, Jones AJ, Pollak MN, Hirst J. 2014. Effects of metformin and other biguanides on oxidative phosphorylation in mitochondria. Biochem J. 462(3): 475–487. ArticlePubMedPMCPDF
  • Carrageta DF, Freire-Brito L, Oliveira PF, Alves MG. 2022. Evaluation of human spermatozoa mitochondrial membrane potential using the JC-1 dye. Curr Protoc. 2(9): e531. ArticlePubMedLink
  • Catalano L, Aminzadeh-Gohari S, Weber DD, Poupardin R, Stefan VE, et al. 2023. Triple therapy with metformin, ketogenic diet, and metronomic cyclophosphamide reduced tumor growth in MYCN-amplified neuroblastoma xenografts. Metabolites. 13(8): 910.ArticlePubMedPMC
  • Chen Y, Gao Y, Li Y, Yin J. 2024. Anti-biofilm activity of assamsaponin A, theasaponin E1, and theasaponin E2 against Candida albicans. Int J Mol Sci. 25(7): 3599.ArticlePubMedPMC
  • Chen J, Ou Y, Li Y, Hu J, Shao LW, et al. 2017. Metformin extends C. elegans lifespan through lysosomal pathway. eLife. 6: e31268. ArticlePubMedPMCPDF
  • Clinical and Laboratory Standards Institute (CLSI). 2017. Performance standards for antimicrobial susceptibility testing. CLSI document M27-A4. Wayne, PA, USA.
  • d'Enfert C, Kaune A, Alaban L, Chakraborty S, Cole N, et al. 2021. The impact of the fungus-host-microbiota interplay upon Candida albicans infections: Current knowledge and new perspectives. FEMS Microbiol Rev. 45(3): fuaa060.ArticlePubMedPMC
  • Du J, Dong Y, Zhu H, Deng Y, Sa C, et al. 2023. DNA damage-induced autophagy is regulated by inositol polyphosphate synthetases in Candida albicans. Biochim Biophys Acta Mol Cell Res. 1871(1): 119622.ArticlePubMed
  • Du J, Zhao H, Zhu M, Dong Y, Peng L, et al. 2022. Atg8 and Ire1 in combination regulate the autophagy-related endoplasmic reticulum stress response in Candida albicans. Res Microbiol. 174(3): 103996.ArticlePubMed
  • Efentakis P, Varela A, Lamprou S, Papanagnou ED, Chatzistefanou M, et al. 2024. Implications and hidden toxicity of cardiometabolic syndrome and early-stage heart failure in carfilzomib-induced cardiotoxicity. Br J Pharmacol. 181(16): 2964–2990. ArticlePubMed
  • Fang CW, Yang JS, Chiang JH, Shieh PC, Tsai FJ, et al. 2023. Metformin induces autophagy of cisplatin-resistant human gastric cancer cells in addition to apoptosis. Biomedicine (Taipei). 13(2): 14–23. ArticlePubMedPMC
  • Feng Y, Zhang Y, Li J, Omran RP, Whiteway M, et al. 2022. Transcriptional profiling of the Candida albicans response to the DNA damage agent methyl methanesulfonate. Int J Mol Sci. 23(14): 7555.ArticlePubMedPMC
  • Gao C, Fang L, Zhang H, Zhang WS, Li XO, et al. 2020. Metformin induces autophagy via the AMPK-mTOR signaling pathway in human hepatocellular carcinoma cells. Cancer Manag Res. 12: 5803–5811. ArticlePubMedPMC
  • González A, Hall MN, Lin SC, Hardie DG. 2020. AMPK and TOR: the yin and yang of cellular nutrient sensing and growth control. Cell Metab. 31(3): 472–492. ArticlePubMed
  • Kang SO, Kwak MK. 2021. Alcohol dehydrogenase 1 and NAD(H)-linked methylglyoxal oxidoreductase reciprocally regulate glutathione-dependent enzyme activities in Candida albicans. J Microbiol. 59(1): 76–91. ArticlePubMedPDF
  • Kher L, Santoro D. 2023. Biofilm models: Different ways of biofilm characterization and drug discovery. Curr Protoc. 3(9): e894. ArticlePubMed
  • Koshikawa T, Abe M, Nagi M, Miyazaki Y, Takemura H. 2022. Biofilm-formation capability depends on environmental oxygen concentrations in Candida species. J Infect Chemother. 28(5): 643–650. ArticlePubMed
  • Krysan DJ. 2023. The mystery of Candida albicans hyphal morphogenesis in the macrophage phagolysosome. Infect Immun. 91(5): e0010423. ArticlePubMedPMCLink
  • Lee DE, Lee GY, Lee HM, Choi SY, Lee SJ, et al. 2023. Synergistic apoptosis by combination of metformin and an O-GlcNAcylation inhibitor in colon cancer cells. Cancer Cell Int. 23(1): 108.ArticlePubMedPMCPDF
  • Li Y, Chang W, Zhang M, Li X, Jiao Y, et al. 2015. Synergistic and drug-resistant reversing effects of diorcinol d combined with fluconazole against Candida albicans. FEMS Yeast Res. 15(2): fov001.ArticlePubMed
  • Lin J, Xiao X, Liang Y, Zhao H, Yu Y, et al. 2023. Repurposing non-antifungal drugs auranofin and pentamidine in combination as fungistatic antifungal agents against C. albicans. Front Cell Infect Microbiol. 12: 1065962.Article
  • Liu Y, Jia Y, Yang K, Li R, Xiao X, et al. 2020. Metformin restores tetracyclines susceptibility against multidrug resistant bacteria. Adv Sci (Weinh). 7(12): 1902227.ArticlePubMedPMCLink
  • Liu S, Jiang L, Miao H, Lv Y, Zhang Q, et al. 2022. Autophagy regulation of ATG13 and ATG27 on biofilm formation and antifungal resistance in Candida albicans. Biofouling. 38(9): 926–939. ArticlePubMed
  • Lu G, Wu Z, Shang J, Xie Z, Chen C, et al. 2021. The effects of metformin on autophagy. Biomed Pharmacother. 137: 111286.ArticlePubMed
  • Luther CH, Brandt P, Vylkova S, Dandekar T, Müller T, et al. 2023. Integrated analysis of Sr-like protein kinases Sky1 and Sky2 links signaling networks with transcriptional regulation in Candida albicans. Front Cell Infect Microbiol. 13: 1108235.ArticlePubMedPMC
  • Lv Z, Guo Y. 2020. Metformin and its benefits for various diseases. Front Endocrinol. 11: 191.Article
  • Mathé L, Van Dijck P. 2013. Recent insights into Candida albicans biofilm resistance mechanisms. Curr Genet. 59(4): 251–264. ArticlePubMedPMCPDF
  • Miceli C, Leri M, Stefani M, Bucciantini M. 2023. Autophagy-related proteins: Potential diagnostic and prognostic biomarkers of aging-related diseases. Ageing Res Rev. 89: 101967.ArticlePubMed
  • Moraes DC, Ferreira-Pereira A. 2019. Insights on the anticandidal activity of non-antifungal drugs. J Mycol Med. 29(3): 253–259. ArticlePubMed
  • Osset-Trénor P, Pascual-Ahuir A, Proft M. 2023. Fungal drug response and antimicrobial resistance. J Fungi (Basel). 9(5): 565.ArticlePubMedPMC
  • Pereira R, Dos Santos Fontenelle RO, de Brito EHS, de Morais SM. 2021. Biofilm of Candida albicans: Formation, regulation and resistance. J Appl Microbiol. 131(1): 11–22. ArticlePubMedLink
  • Podhorecka M, Ibanez B, Dmoszyńska A. 2017. Metformin - its potential anti-cancer and anti-aging effects. Postepy Hig Med Dosw (Online). 71: 170–175. ArticlePubMedLink
  • Rabaan AA, Sulaiman T, Al-Ahmed SH, Buhaliqah ZA, Buhaliqah AA, et al. 2023. Potential strategies to control the risk of antifungal resistance in humans: A comprehensive review. Antibiotics. 12(3): 608.ArticlePubMedPMC
  • Sengking J, Mahakkanukrauh P. 2024. The underlying mechanism of calcium toxicity-induced autophagic cell death and lysosomal degradation in early stage of cerebral ischemia. Anat Cell Biol. 57(2): 155–162. ArticlePubMedPMC
  • Sharma D, Misba L, Khan AU. 2019. Antibiotics versus biofilm: An emerging battleground in microbial communities. Antimicrob Resist Infect Control. 8: 76.ArticlePubMedPMCPDF
  • Shen J, Ma M, Duan W, Huang Y, Shi B, et al. 2023. Autophagy alters the susceptibility of Candida albicans biofilms to antifungal agents. Microorganisms. 11(8): 2015.ArticlePubMedPMC
  • Sturaro MC, de Souza GHA, Damaceno NDS, Silva ON, de Aquino TM, et al. 2024. Antimicrobial activity of ceftibuten/polymyxin B combination against polymyxin/carbapenem-resistant Klebsiella pneumoniae. J Antimicrob Chemother. 80(1): 116–125. ArticlePDF
  • Sun X, Ping J, Guo X, Long J, Cai Q, et al. 2024. Drug-target mendelian randomization revealed a significant association of genetically proxied metformin effects with increased prostate cancer risk. Mol Carcinog. 63(5): 849–858. ArticlePubMedPMC
  • Todd RT, Soisangwan N, Peters S, Kemp B, Crooks T, et al. 2023. Antifungal drug concentration impacts the spectrum of adaptive mutations in Candida albicans. Mol Biol Evol. 40(1): msad009.ArticlePubMedPMCPDF
  • Vyas HKN, Xia B, Mai-Prochnow A. 2022. Clinically relevant in vitro biofilm models: A need to mimic and recapitulate the host environment. Biofilm. 4: 100069.ArticlePubMedPMC
  • Wall G, Montelongo-Jauregui D, Vidal Bonifacio B, Lopez-Ribot JL, Uppuluri P. 2019. Candida albicans biofilm growth and dispersal: Contributions to pathogenesis. Curr Opin Microbiol. 52: 1–6. ArticlePubMedPMC
  • Wójcik-Mieszawska S, Lewtak K, Skwarek E, Dębowski D, Gitlin-Domagalska A, et al. 2023. Autophagy of Candida albicans cells after the action of earthworm venetin-1 nanoparticle with protease inhibitor activity. Sci Rep. 13(1): 14228.ArticlePubMedPMC
  • Xu S, Feliu M, Lord AK, Lukason DP, Negoro PE, et al. 2018. Biguanides enhance antifungal activity against Candida glabrata. Virulence. 9(1): 1150–1162. ArticlePubMedPMC
  • Yang M, Darwish T, Larraufie P, Rimmington D, Cimino I, et al. 2021. Inhibition of mitochondrial function by metformin increases glucose uptake, glycolysis and GDF-15 release from intestinal cells. Sci Rep. 11(1): 2529.ArticlePubMedPMCPDF
  • Yang HD, Zhu QF, Li H, Jiang XL, Xu XQ, et al. 2022. Effect of Neiyi Prescription of QIU on autophagy and angiogenic ability of endometriosis via the PPARγ/NF-κB signaling pathway. Arch Gynecol Obstet. 306(2): 533–545. ArticlePubMedPDF
  • Yu LH, Wei X, Ma M, Chen XJ, Xu SB. 2011. Possible inhibitory molecular mechanism of farnesol on the development of fluconazole resistance in Candida albicans biofilm. Antimicrob Agents Chemother. 56(2): 770–775. ArticlePubMedPMCLink
  • Zhang Y, Kepiro I, Ryadnov MG, Pagliara S. 2023. Single cell killing kinetics differentiate phenotypic bacterial responses to different antibacterial classes. Microbiol Spectr. 11(1): e0366722. ArticlePubMedPMCLink
  • Zhao B, Luo J, Wang Y, Zhou L, Che J, et al. 2019. Metformin suppresses self-renewal ability and tumorigenicity of osteosarcoma stem cells via reactive oxygen species-mediated apoptosis and autophagy. Oxid Med Cell Longev. 2019: 9290728.ArticlePubMedPMCPDF
  • Zhao MM, Wang B, Huang WX, Zhang L, Peng R, et al. 2024. Verteporfin suppressed mitophagy via PINK1/parkin pathway in endometrial cancer. Am J Cancer Res. 14(4): 1935–1946. ArticlePubMedPMC
  • Zhou Y, Wang G, Li Y, Liu Y, Song Y, et al. 2012. In vitro interactions between aspirin and amphotericin B against planktonic cells and biofilm cells of Candida albicans and C. parapsilosis. Antimicrob Agents Chemother. 56(6): 3250–3260. ArticlePubMedPMCLink

Supplementary Information

References

    Citations

    Citations to this article as recorded by  
    • Schinus weinmanniifolia as a natural alternative for the control of skin infections: a multifactorial approach against methicillin-resistant Staphylococcus aureus
      Cleison Leite, João Andrade, Adriana Almeida-Apolônio, Stéfani Rosa, Thiago Castro, Claudia Cardoso, Fabiana Dantas, Kelly Oliveira
      Journal of Ethnopharmacology.2026; 365: 121577.     CrossRef
    • Metformin exerts a dual effect on Mucorales virulence by altering oxidative metabolism through the regulation of rhizoferrin levels
      J Alberto Patiño-Medina, Viridiana Alejandre-Castañeda, César J Torres-Cortés, León Francisco Ruíz-Herrera, Marco I Valle-Maldonado, César R Solorio-Alvarado, Joel Ramírez-Emiliano, Karla Viridiana Castro-Cerritos, Rafael Ortíz-Alvarado, Francisco E Nicol
      Medical Mycology.2026;[Epub]     CrossRef
    • Metformin as a Metabolic Reprogramming Interface in Host–Pathogen and Bone Microenvironment Crosstalk: A Dual-Target Strategy Against Antimicrobial Resistance and Osteoporotic Bone Loss
      Shakta Mani Satyam, Ebrahim Safaii, Ilmia Shameer, Rashmi Kumari, Sainath Prabhakar, Mohamed Talat Zaky Mahmoud Eltrabishi, Mohamed El-Tanani, Abdul Rehman, Mohamed Tarek Mohamed Wageh Mohamed Abdelfattah
      Antibiotics.2026; 15(6): 583.     CrossRef
    • Body temperature drives azole tolerance in Candida albicans by hindering the autophagic degradation of Erg11
      Yanru Feng, Cheng Zhen, Wanqian Li, Malcolm Whiteway, Xinyu Fang, Xuqing Shen, Yuanying Jiang, Hui Lu
      Microbiological Research.2026; 311: 128595.     CrossRef
    • Chloroquine Alone and Combined with Antifungal Drug Against Candida albicans Biofilms In Vitro and In Vivo via Autophagy Inhibition
      Xiao Zhao, Qiaochu Wu, Chenyu Weng, Shuangbo Xu, Yufei Wang, Weiyu Yuan, Xuening Xiong, Wanjing Chen, Xin Wei
      Mycopathologia.2025;[Epub]     CrossRef
    • Updates on Candida albicans infections: pathogenesis, resistance, and emerging nanopharmaceutical strategies
      Marilena Pariano, Matteo Puccetti, Consuelo Fabi, Emilia Nunzi, Sarah Balucchi, Luana Perioli, Maurizio Ricci, Stefano Giovagnoli, Enrico Garaci, Luigina Romani
      Expert Review of Anti-infective Therapy.2025; 23(10): 951.     CrossRef

    • ePub LinkePub Link
    • Cite this Article
      Cite this Article
      export Copy Download
      Close
      Download Citation
      Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

      Format:
      • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
      • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
      Include:
      • Citation for the content below
      Antifungal effects of Metformin against Candida albicans by autophagy regulation
      J. Microbiol. 2025;63(4):e2411008  Published online April 29, 2025
      Close
    • XML DownloadXML Download
    Figure
    Related articles
    Antifungal effects of Metformin against Candida albicans by autophagy regulation
    Image Image Image Image Image Image Image Image
    Fig. 1. Antifungal activity of metformin against C. albicans. (A) Survival rate of C. albicans in planktonic and biofilm after treatment with metformin at different concentrations. (B) The time-kill curves of metformin against planktonic C. albicans. (C) The time-kill curves of metformin on C. albicans biofilms.
    Fig. 2. Effects of metformin on hyphal development of C. albicans. (A) The images of the hyphal development of C. albicans treated by different concentrations of metformin. (B) The hyphal inhibition rate of C. albicans after the treatments of different concentrations of metformin. ***p < 0.001.
    Fig. 3. SEM images of C. albicans in planktonic and biofilm. (A) Treatment of planktonic C. albicans with different concentrations of metformin. (B) Treatment of C. albicans biofilms with different concentrations of metformin. Arrows 1 indicates rough surface, 2 indicates collapse, 3 indicates shrinkage, 4 indicates bulge.
    Fig. 4. MMP detection of C. albicans in planktonic and biofilm. (A, B) Fluorescence images of MMP and ratio of JC-1 aggregates to JC-1 monomers in planktonic C. albicans after metformin treatment. (C, D) Fluorescence images of MMP and ratio of JC-1 aggregates to JC-1 monomers in C. albicans biofilms after metformin treatment. *p < 0.05, ***p < 0.001.
    Fig. 5. Detection of ROS levels and related genes expression in C. albicans. (A) ROS levels in planktonic C. albicans and (B) expression levels of antioxidant-related genes. (C) ROS levels in C. albicans biofilm and (D) expression levels of antioxidant-related genes. *p < 0.05, **p < 0.01, ***p < 0.001.
    Fig. 6. Effects of metformin on autophagy-related genes expression in C. albicans. (A) Expression of autophagy related genes in planktonic C. albicans. (B) Expression of autophagy related genes in C. albicans biofilm. *p < 0.05, **p < 0.01, ***p < 0.001.
    Fig. 7. TEM images of C. albicans autophagosomes. (A) TEM images of planktonic C. albicans in the control group and treated with 16 mg/ml metformin. (B) TEM images of C. albicans biofilm in the control group and treated with 64 mg/ml metformin. The red arrow represents autophagosome.
    Fig. 8. Metformin combined with various antifungal drugs for the treatment of C. albicans in planktonic and biofilm. (A–F) Planktonic C. albicans, including (A) fluconazole, (B) itraconazole, (C) amphotericin B, (D) caspofungin, (E) 5-fluorocytosine, and (F) terbinafine. (G–L) C. albicans Biofilm, including (G) fluconazole, (H) itraconazole, (I) amphotericin B, (J) caspofungin, (K) 5-fluorocytosine, and (L) terbinafine.
    Antifungal effects of Metformin against Candida albicans by autophagy regulation
    Genes Sequence (5’→3’)
    trr1 F: GACCAACTCAAGACCGACGAAGC
    R: GCCATACATCCACTACCAGCAGAAG
    sod1 F: ACAAGAATCCGAATCCGCTCCAAC
    R: AGGACCAGCAGAAGTACAACCATTG
    sod2 F: GAACAAGCCGTTGAAGCCAA
    R: ACCTTGAGAGACAGGAGCCA
    sod3 F: CCAAGGATCAGGTTGGGCAT
    R: AGTACGCATGTTCCCAAGCA
    sod4 F: ACGATACTGCAAGTGCTGCT
    R: CAGCACCGCTACCTTGAGAA
    sod5 F: ACTTTGCTTGACGAGGGACA
    R: CAGCGCCATTACCTTGAGGA
    cat1 F: CCAATTCCAGAACCATTTGCCACTC
    R: ACCATAAGCACCGGAACCTTTAGC
    cat2 F: TCAAGAATGGACGCCACACC
    R: TTCTTCATCGTGGGCAGCAA
    glr1 F: TGACAAGACTTTGATCGCCACTGG
    R: TCCAAGGCAAAGAACCCATCAGATG
    β-actin F: GACCAAGAAGACATCAAGGTATCAT
    R: GTGTTCAATTGGGTATCTCAAG
    Genes Sequence (5’→3’)
    atg1 F: TACAACCCAACTGAGCGGAT
    R: GTAGTGGGTGATGGGCTTCT
    atg2 F: GCCAAGACTACGGGGTATGA
    R: GCCAAGACTACGGGGTATGA
    atg3 F: AACGTGGCAATGGGGTAATG
    R: CGTCCTCCTCTTCCTCTTCC
    atg4 F: AGTGGTAGAGACGCCAATCA
    R: GCACCGGTAATGTATGTGGG
    atg5 F: CATGACTTGGGTTGCTGGAC
    R: TGTTGGCTTCACTCAATTGCA
    atg6 F: GCCAGAAATCAATGCCGCAT
    R: CCATCTACTGCATCCTTGGC
    atg7 F: CTGGGGTGTCAGGAGCATTA
    R: GCATCTACACCGGGGAAAAC
    atg8 F: GCCAGAATTGCTCAGAGG
    R: GATTAATGCAGCGGTTGG
    atg9 F: TACCGCAACACCAACAACAA
    R: CTCCGTTTCAATTGGGGTGG
    atg10 F: GAACGTTGGCAGTTGGGATT
    R: AACCCGTATAGCCCAAACCA
    atg12 F: ACAAGACCCAATCCCAACCA
    R: TGGTTGAATCGACGGTGTTG
    atg13 F: AGTGTCCCGTCGTCTTCA
    R: ATGGAATCCTCATGACCCG
    atg16 F: CCTTTTGGGACATCATTCTTCG
    R: GCGCATCGAAGACATACGA
    atg17 F: CCATCGGAGTTCAAGCTTCC
    R: TCCGGTGATCATGTCCATCA
    atg27 F: GCCACCTTCGCAAACAAA
    R: TGAAACCAAGCACCACCA
    ccz1 F: TGTCTCCCAAAGCCGAATCT
    R: GTTGTTGTGGACGTGGTTGA
    Drug combination with metformin Planktonic
    Biofilm
    FICI Interpretation FICI Interpretation
    Fluconazole 2 IND 1 ADD
    Itraconazole 0.75 ADD 0.75 ADD
    Amphotericin B 0.375 SYN 1 ADD
    Caspofungin 1.5 IND 0.125 SYN
    5-Fluorocytosine 3 ANT 1.5 IND
    Terbinafine 1.125 IND 1.25 IND
    Table 1. Primer sequences of ROS related genes used in the present study

    Table 2. Primer sequences of autophagy related genes used in the present study

    Table 3. The interactions between metformin and antifungals on C. albicans using the FICI model

    SYN: synergism; ADD: additivity; IND: indifference; ANT: antagonism


    Journal of Microbiology : Journal of Microbiology
    TOP